Hi Christine - JJC recently made a presentation to quite a large audience at "Red Pill Expo Study Hall" (18 June). I've seen several substack commenters posting it so you may have seen it already. If not & if interested, see https://www.twitch.tv/videos/2175381494 His presentation begins around 18min mark (skip 1st 10 mins or so spent throwing ex-CHD colleagues under the bus). I must say I found it just as confusing as his previous presentations but you might find something of interest in it, one year on.
Hi Kerrylyn. I watched up to 1:08:25 and found him as incoherent and full of himself as ever. Still referencing "viruses" and putting no-virus people down, but fails to show where we are wrong about anything. Implies that the fake "virus isolation" cell cultures demonstrate transfection, when the virologists simply observe cells breaking down and pretend that is evidence of a virus. Makes it sound like we have "only" addressed some of the fake "virus" evidence. I bet very few people in the audience would be able to accurately explain in their own words what his claims are other than "I'm the smartest and most honest and no one will listen to me and there's something wrong with everyone else".
Great work Christine. I watched the video with yourself, Dr Tom Cowan, Dr Andrew Kaufman, Alec Zeck and Dr Mark Bailey and the discussion around JJ Couey and mischaracterization and was taken aback at his extremely childish responses.
Waving about x-number papers and claiming 40 years of studies as his evidence is astounding. He ignores the fact that as was pointed out by Professor John Ioannidis paper "Why Most Published Research Findings are False".
Many papers simply use references from previous studies as evidence and we know that the measles study by Enders did not follow what we know as the scientific method. Dr. Stefan Lanka showed it to be so.
If the research or experiment has no controls it is false. He, Couey as a biologist should be aware of that. It's a basic fundamental
Slightly off topic, but I saw the best no virus talking point yesterday. Apparently, people who were vaccinated last year for Monkeypox in Chicago are having something of a relapse epidemic. So Monkeypox uses the oldest of old school of vaccines: live Vaccinia/Cow Pox. One brand, ACAM2000, is very old school, and is still cut into your arm, the other brand, Janeos, is injected, like flu/MMR/coof etc. The records of the last 600 years (remember, Jenner started the switch to Vaccinia/vaccination in 1790s, but direct Smallpox inoculation is over a millenia old and began in Europe in ernest in late 1500s/early 1600s), these records, clearly showed many did not buy the innoculation/vaccination theater and from the start said it does not prevent infection, but actually spured outbreaks, and caused the disease. Well, now we see the centuries derided naysayers appear correct. If the God of vaccine theater, Vaccinia, is a dud, they have nothing. Vaccinia is the key stone, and it is just plaster of paris. If you can pull people like Couey off of mRNA and make him explain why Vaccinia is a real thing but also a trick, maybe he will fully wake up. As long as people can talk about new, faulty vaccines, they have squiggle room. This takes the convo back to first principles, all vaccines are nonsense, many are not harmless, and they can't work because there is no there there.
I am placing this message here at the top of your comments section so it actually gets VIEWED and by the greatest number of people. The "drama" of the last few days is an example of what can happen when an anonymous online IDIOT decides he's a freakin' KNOW-IT-ALL and he knows more about historical events or movements than an OBVIOUS veteran who WAS ACTUALLY FREAKIN' THERE! I took great pains to offer the documentation that we made concerning much of what transpired in our dear old, NOW-DESTROYED "AIDS" dissident movement which we posted at the following link:
ONE GOOD THING that has arisen out of all of these misinterpretations and misunderstandings is that the persistent IGNORANCE of one of Christine's commenters here has permitted me the opportunity to explain and RE-EXPLAIN for you readers what actually happened in and to our old "AIDS" dissident movement. As anyone can see who is NOT burdened by reading comprehension deficiencies and who takes the time to read the above link, there are NUMEROUS allegations we made (along with proof from e-mails from --and actions taken by- Duesberg and his "THUGS") that there WERE INDEED many acts of suppression and censorship perpetrated by the Duesberg faction against Eleni Papadopulos-Eleopulos and her "Perth Group" of dissenting "AIDS" researchers.
These included e-mails from Celia Farber in CELIA'S own words which Celia CHOSE to use in MANY e-mails that she CHOSE to send (many of which I STILL HAVE). The confusion around Celia's role may stem from the fact that she proved to be a very useful idiot for the Duesberg Cabal, but I get the feeling that Farber was not always involved in the "Cabal's" plans. Celia was more of an incessant cheerleader --and she still is to this day-- for her hero and "Daddy figure" Peter Duesberg. Celia's e-mails were directed both privately to smaller groups of individual supporters of the Perth Group (sometimes but not always including yours truly) as well as more publicly to VERY LARGE lists of e-mail recipients.
Much of this "civil war" was carried out semi-privately starting in 2008 via a large and varying (over time) list of e-mail recipients of HIGHER LEVER members of the "AIDS" dissident movement. I was considered --at least for these purposes-- one such "higher level" "AIDS" dissident who was "privileged" to be placed on the ever-changing recipients' list much of the time. Some exceptions were some private replies that were sent by Celia and others, many of which I have also received from third party recipients since then. There were several even more private e-mail threads, many "sub-discussions", that took place among even smaller groups of recipients. We certainly had many private discussions of our own that were also carried out via e-mail by a small group of us Perth Group supporters, including yours truly.
For a few months in 2009, the discussions and fights were also occurring on an old "Yahoo Groups" group, before DAVID CROWE threatened legal action (as he was WONT to do back then) against the owner of the Yahoo Group, and the owner then deleted ALL of our discussions! (See: http://www.tig.org.za/Paradigm%20posts.htm for some snippets from some of those deleted discussions).
At any rate, Celia Farber is absolutely LYING--(or suffering from early onset memory loss??)-- when she now claims that no one was ever trying to stop Eleni or the Perth Group or suppress the Perth Group's efforts! We have taken the time to document the histories of BOTH the original "Rethinking AIDS" group of which I WAS a small contributor (I copy-edited the old newsletters from the OLD, original "RA" group) AS WELL AS all the more unsavory history of the NEW, Rethinking AIDS "2.0" group that Duesberg and his cabal decided they needed to revive circa 2005 (with a lot of assistance from the always willing, dutiful and EAGER DAVID CROWE!).
Those histories are still available at the following link:
The opportunities for our old "AIDS" dissident movement in South Africa vis-a-vis President Mbkei's AIDS Advisory Panel were the greatest, most significant opportunities that ANY medical dissident movement EVER HAD! The history of what transpired and what did NOT transpire in South Africa is also documented at the histories #s1 through 6, available at the link above, and there are even more analyses at the following links:
I may comment later about the old exchanges in Continuum Magazine that took place between Duesberg and the Perth Group which Christine has referenced below. That "drama" that occurred in 1996-97 may need some clarification, too. However, that "event" was not only much older but, in my view, it was also actually much less injurious to the Perth Group and the "AIDS" dissident movement at large than the debacle that took place in South Africa in the early 2000s and all the subsequent Machiavellian acts of deceit that were perpetrated by the Duesberg cabal later on once they resuscitated the RA "2.0" group circa the mid 2000s.
BIG THANKS to those who actually LISTEN and those who aren't afraid to have their heroes questioned!
While AIDS dissidents were busy arguing if the Perth Group was right or Duesberg was right, no-one was reading Alan Cantwell or Len Horowitz or Ed Hooper. I didn't find references to any of them on your old website.
It's just like with COVID. We have people arguing if the no-virusers are right or if the no-virus-lite guys like JC are right, and no-one is reading Daoyu Zhang or Steve Massey or Istvan Csabai or Jesse Bloom or Sudhir Kumar.
If I wanted to create and release a virus which kills millions of people, a cunning scheme to throw dissidents off my track would be to insert one group of people into the dissident movement who say that my virus is fake, and to insert another group of people who say that my virus is real but not pathogenic, and to then waste everyone's time by staging a bunch of fights between those groups.
Three years ago Andrew Kaufman entered into alt media out of nowhere through flat earth channels, his first viral presentation was written, produced, and livestreamed by an ex-military Luciferian freemason flat earther, and his Hippocratic Hypocrisy film was narrated and produced by another flat earther who used to work for the pharma industry. A bunch of useful idiots followed, like for example Massey who said that she embarked on her FOIA crusade after she heard Kaufman's early presentations.
Duesberg said that HIV does not cause Kaposi's sarcoma, even though he used to work for the Special Virus Cancer Program whose purpose was to construct cancer-causing viruses.
Now in the past half a year, a faction of neo-Duesbergians has emerged who say that viruses are real but that SARS 2 is not the cause of COVID. Their leaders include Mike Yeadon who used to work for Pfizer and who worked at Porton Down under military clearance, Karen Kingston who used to work for Pfizer and who said that COVID vaccines contain hydras and snake venom, Sasha Latypova whose company iCardiac did a multimillion-dollar deal with Pfizer and who did her alt media debut on the Stew Peters Disinformation Network, and JC who wears a Mossad t-shirt.
Mike Yeadon has moved on from the idea of respiratory viruses, and once again the onus is on those who claim that such a thing, whether natural or manmade, exists.
Feel free to share your proof of any staged fights.
May 11, 2023·edited May 11, 2023Liked by Christine Massey FOIs
Dude whoever you are, you have no idea what you are talking about, and you are in WAY over your head, here! Your referring to Christine as a useful idiot has to be the most blatant example of PROJECTION I've seen in a very long time! I think Christine might feel compelled to reply to you, but in the meantime let me warn you by saying something she would probably say in this instance:
Whether we are referring to Anthony Fauci or Robert Gallo or Luc Montagnier or Alan Cantwell or Len Horowitz or Peter Duesberg or ...ahem.....YOU, the onus remains where it has always been:
The person claiming that there IS a virus, WHATEVER virus they are claiming exists, needs to show PROOF for said virus!
So.....show us PROOF of ANY FREAKIN' virus already!
I have already shown the proof to Massey many times, but she has always refused to follow my instructions and she just replies with something about "in silico" or "unknown provenance" or "particles". If you have some basic coding skills, an easy way to learn more about virology is to learn how to do bioinformatic analysis of viruses. You can get started by running the shell and R code in this file: https://cdn.discordapp.com/attachments/1093243194231246934/1103852719355211887/sars.html. Once you learn enough about virology, you'll learn that viruses are real. Doing FOIA requests clearly isn't an efficient way to learn about virology if Massey still believes that viruses do not exist after doing over 200 FOIA requests.
Sorry, but you are really quite ignorant and gullible - so you think that if you take nucleodite sequences from dead cells and string them together, you will get a fictitious virus...? It's will nevertheless always remain only a string of nucleotide sequences of excreted cell debris!!! Apparently you are not aware of why and especially what really makes people sick!!!
And this is a completely natural procedure to keep the organism alive and healthy - why do you think that it is always necessary to ensure babies and small children sufficient sleep - because cell division takes place in rest/sleep and they need this to promote growth and health!!!
Why do you want to drag logically thinking people again and again into this tissue of lies??? Do you get paid for it, or can you just not admit that you let yourself be lied to, manipulated and deceived over a long period of time to take these poisonous substances...? and did you possibly even get side effects.... well, then I suggest that you contact exactly those who are responsible for this and who lied to you and deceived you!!!
I opened the first post you linked. In your spreadsheet, you indicated that the reverse primers like ACGATTGTGCATCAGCTGA didn't match SARS 2. However the reverse primers attach to the reverse strand, so you have to reverse the primer sequence and flip A and T letters and flip C and G letters. So then for example TCAGCTGATGCACAATCGT ends up being identical to positions 13442-13460 in Wuhan-Hu-1.
Also in your spreadsheet you crossed out degenerate bases like the Y letter in AYCACATTGGCACCCGCAATCCTG, and you didn't specify if primers with degenerate bases matched SARS 2, even though Y matches either C or T, so the Y matches the T in ATCACATTGGCACCCGCAATCCTG, which is located between positions 28704 and 28727 in Wuhan-Hu-1.
You can use `seqkit locate` to search for the primers on both positive and negative strands, and you can add `-d` to include matches for degenerate bases:
The output shows that I was left with only six primer or probe sequences with no matches. Three of them were part of a primer set which was used as a control in a protocol by the US CDC and which targeted the human RNase P gene (https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7392423/).
Out of the remaining three sequences with no matches, two were the reverse primer and probe from a primer set which was meant to detect other SARS-related viruses and not just SARS 2: "Charite RdRP_SARSr Pan Sarbeco FAM-BBQ-650" (FAM-CCAGGTGGWACRTCATCMGGTGATGC-BBQ650) and "Charite RdRP_SARSr Reverse Primer" (CARATGTTAAASACACTATTAGCATA) (https://www.biosearchtech.com/charite-2019-ncov-bbq-650-probes-primers-valupanel-reagents). The reverse primer and probe match a bunch of other SARS-like viruses, which is their intended purpose:
Output: https://pastebin.com/raw/cL3ic5YP. The same primer set also includes a second probe which is meant to match only SARS 2 ("Charite RdRP_SARSr 2019-nCoV FAM-BBQ-650 Probe").
The sixth sequence with no match was the Japanese NIID_2019-nCOV_N_R2 primer which had one mismatch, because it should've been TGGCAGCTGTGTAGGTCAAC but actually it was TGGCAGCTGTGTAGGTCAAC. For some reason they originally used the correct primer but they later issued a correction which said that "the reverse primer (NIID_2019-nCOV_N_R2) sequence should be replaced with TGGCAGCTGTGTAGGTCAAC." (https://www.who.int/docs/default-source/coronaviruse/method-niid-20200123-2.pdf) I don't know if it was some kind of an error, because I didn't find any 100% match for the updated primer on BLAST. And in NextStrain's global subset of about 3,000 SARS 2 sequences, I didn't find a single sequence which matched the updated primer (https://docs.nextstrain.org/projects/ncov/en/latest/reference/remote_inputs.html#summary-of-available-genbank-open-files):
Can you point out any articles where the Perth Group provided a detailed explanation of why they claim that the methods that are used to do genetic sequencing and assembly for viruses are not valid, or how they claim viral genomes are fabricated? Or have they provided an explanation for why the genomes of viruses appear to evolve over time so that different variants emerge in different parts of the world? Or have they published articles where they tried to use genetics software to assemble viral genomes themselves?
at Enter Query Sequence, scroll down to the blue box on the left, click on it and wait for the result.
And why did some people get sick:
The chemical bases of the various AIDS epidemics: recreational drugs, anti-viral chemotherapy and malnutrition - PETER DUESBERG, CLAUS KOEHNLEIN and DAVID RASNICK
It’s going to be difficult for JC to acknowledge he was wrong because he acted like such an asshole in presentations I saw. Had he been an intellectual researcher, and more importantly a graceful communicator, he would not now be in the position of strategizing on how to save face. Maybe he will apologize for some stupid/ offensive things he said. Maybe he will turn his anger upon the system that trained him. It seems he’s going through the process, thanks to you Christine and others who have made him reconsider his faith in virology.
In the first podcast of 20:26 duration Jon explains again his process to understand how HIV was not the cause of AIDS. This is the 1980s, before Jon understood there were no viruses. By the end of that podcast he compares Duesberg and Papadopulus and the Perth Group, HIV exists but it does not cause AIDS, versus HIV was never shown to exist.
In the second part, of 57:09, Jon addresses the issue of the division of the dissidence over the issue whether the non-existence of SARS-CoV-2 is the most important issue. This is compared with the nasty backstory of infighting in the AIDS dissidence. His tone is conciliatory.
Jon insists "this is a war" and (33:40) he says it is astonishing to have a war based on something that does not exist.
Then he talks about the problems of vaccines in general, and the people who have spoken about vaccines over the years.
Then he speaks against Rockefeller's germ theory. A marketing model.
"The failure of isolating SARS-CoV-2 virus is not only about that virus is about most if not all viruses. My strong inclination is that it affects all viruses."
Jon shares one comment in conversation by Barbara Starfield of Johns Hopkins: that researches need to look the body as a whole, and not what they were doing: disease-cause-treatment.
Diseases are not single entities with single causes, and this truth has to be kept hidden because it is damaging to the marketing plan and to the plan to control the populations.
Then Jon speaks about the unexplored area of the effects of the thoughts on the body, for health and disease.
Jon also criticizes the immune system as a faulty metaphor based on military language. "Let's not assume that the immune system is a thing, a military force." "let's contemplate all the things and processes together."
He ends the podcast repeating that Peter Duesberg is a hero, and a great figure in the history of counter-medicine.
This was published last Thursday 2nd of May, before the little fight we the commenters of this substack unfortunately had the on days 6, 7 and 8.
That man I was talking with comes from that nasty infighting of the past. We should focus on the solutions. Solutions, in the plural. Because this is not about our feelings, but against global fascism.
The division has been over whether or not SARS-CoV-2 has been shown to exist. Some insist it does, and some say that it doesn't matter for now (an absurd position to take).
Jon has been clear for a long time now: it has not been shown to exist. I hope he was clear about this in the podcast.
A few months ago, I left a comment here on my take on Jay. I had never heard of him, was recommended him as someone who would win me back to yes virus. I watched one video interview of him from Dec 2022and, as I said here, he appeared to be a hot muddled mess, deeply in the throes of cognitive dissonance and ego fortification. Even then it was clear he truly no longer accepted yes virus, but he just couldn't quit it. He talked of virologists tricking themselves (as opposed to just being liars), he talked of viruses being ghosts (because if you want to convince me of imaginary things, use imaginary things!), and he said the reason you have to be yes virus is because the risk is too great if they really are real (i.e. the check for under bed monsters, to be safe, not sorry). Aside: there are no treatments for viruses, just the crude sympathetic magic warding ritual to make it pass you by, so actually, there is no benefit to calling it a virus instead of a demon infestation or just a bad day. My own switch was much easier and quick, like Yeadon's, but it helps to be ontologically flexible and to have no ego bonds or relationship bonds to yes virus. Plus, this really started for me back in the 90s with HIV, but I gave up on that, moved on, only tomrealize why having won back then was a critical lost opportunity that allowed 2020 (same cast of characters as HIV). I've since seen Jay taking on a lot of the "freedom hucksters" and my opinion of him softened. I think he will get here sooner rather than latter, so long as he doesn't fall in love with his clones idea and reattach his ego to the lie. Yes virus has only one objective, to maintain the vaccine death theater resource grab loosh farm that has been going on for 600 years. Just say no...virus.
I have already added another reply, this one to Jeff Sims so that I could further explain to HIM why I expanded my comments about Celia Farber in my reply to his message. It needs to be emphasized why ALL OF THIS NONSENSE and threatening posts on Celia's stack came about, like a nightmarish game of "whisper-down-the-alley" being played by presumably all adults! It was because a "newbie", Jeff Sims, revealed that Celia had apparently "unleashed" her "emotional outrage" on HIM! What was Jeff's "crime"? Questioning Jon Rappoport! As I keep recommending, Celia needs to be IGNORED! It is my understanding that YOU, Christine, witnessed similar "emotional outrage" from Farber, no...?? If anyone needs evidence from ME, I could post some of the old "love letters" that Celia sent me....?? LOL! Let me know! I'm just not sure that they are particularly appropriate for THIS comments section, and I might like to retain them for further purposes should the need arise.
Again...for anyone who is still unclear: this is about TAKING RESPONSIBILITY for one's past support of FLAWED science! (Remember: this IS a *SCIENTIFIC* issue!) As I have stated elsewhere, ALL of us old-time "AIDS" dissidents have supported the great and "respectable" Peter Duesberg for at least some length of time! This includes yours truly! Some of us learned, however, to STOP that support, and some of us came to that conclusion a LONG TIME ago (like DECADES ago, in fact)!
At any rate, as for "Cosmos" you can decide what to do about him. After all, it IS your substack. However, I hope you can see how he really does drag down the quality of comments on here! It is my understanding that there ARE settings that you can control pertaining to who you allow to post comments on your own content here on substack.
I am copying my new reply to Jeff below:
As for the comment below from "Cosmos":
"Cosmos" has already stated numerous times how stupid he is and how much more simply he needs things to be explained for HIM!! He has also demonstrated repeatedly how profoundly IGNORANT HE is of all of the pertinent facts being discussed here including these historical FACTS about our old "AIDS" dissident movement! I only expanded my comments about Celia so that Jeff would feel better about the emotional outrage that she felt she needed to unleash on HIM!
It is quite well known among our "no virus" faction that this is a VERY common occurrence where Celia unleashes her wrath on new AND old members of the "no virus" faction who dare to question HER heroes and their STUPID defense of virology! It's OBVIOUS to anyone who investigates her closely that Celia is INSANE!! I've been calling her that for YEARS and she's never tried to sue ME! (BIG HINT: if you do not want to be called insane, then you should not send people multiple private e-mails where you really SOUND INSANE! I could have- and perhaps SHOULD have-- pursued CYBERSTALKING charges against HER!)
Not only that but, as I tried to point out to all LITERATE readers in my earlier post, it is lesser known that, as Farber HERSELF has admitted, she was utterly SH*T on by HER heroes in our old "AIDS" dissident movement! Also, I NEVER claimed that she ever received one red CENT for her ill-advised and zealous defense of her "Daddy figure" Peter Duesberg!
Unlike "Cosmos", I have already stated numerous times who I am and have provided my own background which is ALWAYS available for ALL to see in my profile on here --- and it's IN MY OWN FREAKIN' REAL NAME!!
If "Cosmos" truly had any BALLS, he would REVEAL his OWN identity! If not, then he needs to kindly STFU!! If he refuses to reveal his identity, then he should leave the adults here ALONE and go bother his *8* subscribers if they can STAND HIM!
Three, you have recycled your reply to my critical comment, that's shameless self-plagiarism. Not that I care, but just so you know.
Fourth, I bring a lot of life and comedy and healthy pushback to this great substack. You should go back to the archives and read everything, you would have a blast!
Fifth, I happen to be a paying member of this lovely substack, Rod. Not that this fact gives me any privilege, the owner can ban me any time she wants. Christine is a fair human being so she would give me a warning and a good explanation. I try to be the change I want to see in the world. I'm all kumbayah and flower power. If I'm asked politely to go to the corner to play with my lego nuke launcher and use my imagination, I will. But you should raise your level of argumentation, stop the stupid caps, and apologize to Celia, Jon and Peter.
Don't be a Jerkasaurus, Rod!
--
P.S. What is your astrological sign? Are you a virgo sun or ascending? I heard that maladjusted Virgos can be very irritating people.
But watching your abuse of uppercase letters, I think you are a Gemini with Mercury retrograde. Your natal Mercury is mocking you. You have to step up and show him who is boss!
"You have already stated numerous times how stupid you are and how much more simply you need things to be explained for you!! You have demonstrated repeatedly how profoundly ignorant you are of all of the pertinent facts being discussed including these historical facts about our old "AIDS" dissident movement! I only expanded my comments about Celia so that Jeff would feel better about the emotional outrage that she felt she needed to unleash on him! It is quite well known among the "no virus" faction that this is a very common occurrence where Celia unleashes her wrath on people who dare to question her heroes! Unlike you, I have already stated numerous times who I am and have provided my own background which is always available for all to see in my profile on here --- and it's in my own beautiful real name!! Who in tarnation are you anyway???!! Care to reveal yourself, you astonishingly sagacious stranger??? If not, then kindly remain silent!! Hopefully this sentence is short enough for even you to understand: Leave the adults here alone! Go bother your eight subscribers if they can stand you."
----
I've also altered some of his minced words, for the sake of comedy.
I don't know what kind of emotional nightmare did Jeff Sims go through. Please, Jeff, tell me that story.
----
I've sent an email to Celia Farber after writing a comment on this on her stack. Since she is attacked, I wanted to know her side. This guy Rod was so weird. Celia seems motivated to defend.
I want to repeat that I agree with Jon Rappoport on the admonition to not eat our own. Fights can be fun, but let's focus on the real issue.
----
Also, since Rod asks who am I, I am only an internet commenter with a pseudonym and an interest in justice and learning what is happening and what can I do.
I often bring links and quotes from videos to learn more about our situation.
People who read my comments know that most of the time I encourage people to overcome helplessness and to take care of their own health and fight against the global tyranny. That's just me.
I think we need to hire a Catholic priest to do an exorcism on all these folks who know the truth yet cling to falsehoods. Purge them of the cognitive dissonance that (some) viruses exist yet none ever proven to exist. Get them to come clean. Or maybe a specialized rehab facility for germ theory adherents who understand it is a lie.
I am a great example of skimming over something due to being in a hurry and failing to get the meat of it, thinking a dab of salad dressing was the meal... I should know better;
I apologize for that. I thought we had a convert... I keep thinking all this is going to fold and collapse in on itself like the Twin Towers... Now that I've given it a better look, it seems the Poseurs are trying to keep their cred, with more CYA-ing and tiptoeing around the actual issues and trying to be "innocent" until proven pathological.
I still think the non-existence of viruses is going to blow a HUGE hole in many, many things, and we should persevere.
So again, Thank You, CM, you're a gentlewoman and a scholar-- and an excellent Prize Fighter, too, I might add-- Ali would be proud.
Even RFKJr has privately admitted in emails that viruses don't exist but says he can't speak out on it. Don't have the link at hand but it was in one of Eric Coppolino's stack articles re: no virus debate & Eric has been all over the CHD/Bobby Jr. reluctance to go there for a couple of years now. Check him out.
That's not what RFK said, but he said: "I'm grateful for your courage and intellectual integrity. I have an open mind on this issue but no bandwidth to spend the time energy and credibility capital to personally investigate it. I feel the same way towards those people who passionately and knowledgeably argue that 9/11 is an inside job. It could be true. But there are opportunity costs in taking on this cause and I think diminishing returns to my overall effectiveness. I cannot right every wrong or expose every falsehood. I need to be strategic In choosing my battles. If you reflect, you will find that you do the same. I admire and encourage you but I must beg off on this war for the time being. I'm more likely to join if you get it nearer the goal line where the cost/returns ratio improves." (https://planetwavesfm.substack.com/p/why-is-robert-f-kennedy-jr-running)
About half of RFK's book "The Real Anthony Fauci" was about HIV, and RFK wrote extensively about Duesberg and he presented Duesberg's theory on AIDS. RFK also mentioned the Perth Group on two occasions:
> Among the most outspoken dissidents of the HIV orthodoxy are biologist Eleni Papadopulos and physician Val Turner of the Australian Perth Group. Papadopulos and Turner believe the particles Gallo identified as HIV are not even retroviruses, but rather are a class of cellular debris generated entirely from within the human body. Even Luc Montagnier admitted in an interview with the journal Continuum in 1997 that after 'Roman effort,' with electron micrographs of the cell culture, with which HIV was said to have been detected, no particles were visible with 'morphology typical of retroviruses.
> [...]
> Other respected scientists took Duesberg's doubts even further than Duesberg. Led by Dr. Eleni Papadopulos and Dr. Val Turner, The Perth Group in Australia argues that Gallo's claim was altogether specious and that neither Gallo nor Montagnier had ever succeeded in even isolating a discrete HIV.
> In my conversations with Turner and Papadopulos, and in my reading of their paper, I find their arguments clear and convincing. However, I recognize that there are some fifty thousand articles on AIDS in the scientific literature. A casual novitiate like myself has little chance of unraveling this baroque controversy in a vacuum. Without rigorous debate, the public and press must form opinions based upon appeals to authority - a feature of religion, not of democracy or science. Any debate on that battleground will always be won by self-interested government and industry officials who control the bullhorn and the media.
RFK's book was dedicated to "that battle-hardened cadre of heroic scientists and physicians who have risked their careers, their livelihoods, and their reputations to champion evidence-based science and ethical medicine", which included a total of 46 names. His list was followed by "The Heroic Healers Honor Roll" which featured both people from the no-virus camp (Tom Cowan) and people from the camp which claims that HIV exists but is not pathogenic (Peter Duesberg, David Rasnick, and Kary Mullis). I didn't find anyone from the camp of Cantwell and Horowitz though.
He basically admitted that he knows virology is rubbish. And that is not his only communication that is on record, plus there are comments from Mary Holland on record. They know.
May 7, 2023·edited May 7, 2023Liked by Christine Massey FOIs
RFK Jr. seems to feign ignorance in his book on Fauci where he definitely takes a more pro-Duesberg stance on the “HIV” issue. As Mongol pointed out, RFK justifies his stance by claiming that he is too much of a “casual novitiate” who “has little chance of unraveling this baroque controversy in a vacuum”, i.e., all the complex issues that were raised during our old “AIDS” dissident movement by the late Eleni Papadopulos-Eleopulos and the Perth Group of dissident “AIDS” researchers that she led ( http://theperthgroup.com ).
However, RFK Jr. also seems blissfully ignorant of the fact that it is not advisable to argue simultaneously-- as he DEFINITELY does in his book-- that, on the one hand, "neither Gallo nor Montagnier had ever succeeded in even isolating a discrete HIV" and on the other hand, that HIV is a virus which definitely exists but is a "harmless passenger virus". Of course, as you know, Duesberg's theory --which is like arguing that there are "toothless vampires"-- is demonstrably wrong on the science. However, it's also true that the two theories are CONTRADICTORY, like "oil and water". As an attorney, RFK Jr. SHOULD be smart enough to know that such a strategy would never work in any court case (See: http://www.tig.org.za/Legal%20strategy.pdf ).
Most likely, RFK Jr. is familiar with the real history of our old "AIDS" dissident movement (See: https://tig.org.za/RA.htm ). Unfortunately, as you know, we "AIDS" dissidents allowed these two aforementioned competing theories to co-exist in our old "AIDS" dissident movement. It didn't work! Our "AIDS" dissident movement proved to be a HUGE FAILURE, in large part because we allowed Duesberg and his supporters to continue in our movement for far too long (see also: https://tig.org.za/TIG_Position_Statement_on_HIV.htm ).
If RFK Jr. does know that virology is rubbish and he is familiar with the history from our old "AIDS" dissident movement, then the question remains: why is RFK Jr. repeating this same mistake of allowing two contradictory theories to co-exist?
Have you noticed that since genome sequencing and the advances in bioinformatics, they say "oh, well, we don't need to have a virus, we can just sequence that from a complex sample, and the Koch's postulates were never valid, we have better standards of proof and reasoning like the Bradford-Hill criteria"?
I think that is tailored to meet the rhetorical needs of politicians and PR people. The ambiguity and the air of the new thing takes over everything and the muggles put on the deer-in-headlights face.
If a politician needs to move this way a little, they can say something that rhymes with this scientific model. If the next day they need to move in a different direction, they can repeat some random phrase from a textbook. Everyone is happy.
They never have a valid independent variable to do any science with! And Bradford-Hill criteria cannot be applied to imaginary particles lol. And they can't even demonstrate contagion. Anyone who thinks that finding sequences somehow proves the existence of a "virus" needs their head examined. Or, they are just bamboozling people with fancy-sounding technology.
I used to think, before I read, that the magic soup was like a layered image in a picture editing software, where one can activate or deactivate layers of superimposed images, alter the blending method and the opacity, and so on.
So, I imagined (wrongly) that they can just use this antibiotic or this antifungal to hide interference from germs in the culture, to make sure that only the virus was doing something. And then, compare with a true negative control.
No such thing! LOL! It's all fake!
And after I learned that, it was easier to see the biggest (IMO) problem, the isolation and purification and further chemical characterization. That step is necessary. Computers cannot save that work. That's worse than cheating.
Much later, I learned they claim purification cannot be done because viruses are labile. That means when they try to filter them to get only the unicorns they decompose and they don't work. That means the whole concept is false! The virions cannot do what they say they do.
Or show that as the replicated infective particles lyse the cell they can make it to the next cell and not decompose in transit. How come viruses are not labile inside the living body? It's impossible.
Yes, thank you Christine. The private email & conversations I read in the stack were not the ones that Mongol wrote about above. Agree that both Mary & RFKJr are aware the proof that viruses do not exist is irrefutable but they are still dissembling.
In case Mongol isn't sure about my meaning here, dissembling means hypocritical; false, to conceal facts, intentions, or feelings under some pretense or putting on a false appearance. Bobby & his CHD organization are dissembling to stay in business so the naysayers won't call names & attack CHD's "integrity". So CHD lies instead.
I don't think JC ever explained why he wore the t-shirt. It may have been to troll Kevin McCairn, who two days earlier did a stream about J. Bart Classen's paper which said that Mossad did COVID (https://rumble.com/v2b2zdo-world-war-shlomo-part-2-lab-leak-psy-op-classen-and-mossad-covid-klaus.html). At that point JC had been in a streaming war with McCairn for a few months after McCairn and Rixey called out his clone theory as nonsense. But why would JC have bought the Mossad t-shirt in the first place? What was the point of just wearing the t-shirt on a stream without ever explaining why he wore it?
On a list of "DRASTIC's key breakthroughs and research" compiled by Charles Rixey, the first entry is that Dan and Karl Sirotkin co-authored a blog post about the lab leak theory which was published on January 31st 2020, and the second entry is that JC started posting YouTube videos about COVID in February 2020 (https://i.ibb.co/3yjWYNN/drastic-key-breakthroughs.png). Out of the videos that are currently visible on JC's YouTube channel, the very first video about COVID was a video about the blog post by Dan and Karl Sirotkin (https://www.youtube.com/@JConabike/videos).
On Rixey's list of DRASTIC's key breakthroughs, the 4th, 5th, 6th, and 7th entries are about work done by Yuri Deigin, but Deigin also posted a tweet where he said: "PS: for the record, I am against censorship. Even for Holocaust deniers. And I'm half Jewish." (https://twitter.com/ydeigin/status/1396928014454304770)
George Webb has been moving in the same circles as JC for three years now, and for example they were both doing videos with Addy Adds and the Jew Paul Cottrell early on, but George Webb has said that he has homies at French Mossad: "(0:09) All my French Mossad homies want me to do a shout out to Francis Cabrel. [...] It's just the spycraft and the beauty of how Mossad does shit. You know, I just - especially the French Mossad is just really fantastic spycraft. And really the antecedents of that go all the way back to World War 2. This is when they were working with OSS - and I've said this before - they would have these radio shows at night where they would do different songs, play different songs, and the songs were encoded. Certain songs would mean blow up the local railroad. Thanks Mossad homies and [something Français?] because you've helped me out so much in this. [...] (1:00) One of the things that's been so hard for me in this series is playing the Mossad thing. Because so many people have come out against Mossad and how evil Mossad is and so forth. [...] (1:14) So that's - I'm always rooting for Mossad secretly kind of. And this is what that is. [...] (1:35) My sources, and I'm - you saw French Mossad today, you know, give me some stuff. [...] (2:54) And then there's the great Mossad, which was fundamental to the survival of Israel. I know people are going to say we did a lot of stuff. And you know with the Lebanese babies and the Yemeni babies and Palestine and - I'm not getting into that, I don't want to get into that, organ harvesting and all this. We can do business the old way, we still make a lot of money, make everybody happy, make movies, whatever we do. [...] (4:37) I do have [unintelligible] ties with Israel. [...] And I'm with the old guard. You know, the Negev Brigade, and Ben-Gurion, and Avi Braverman." (https://www.youtube.com/watch?v=dKBC3gChmKQ)
JC worked as a research scientist at the Erasmus Medical Center in Rotterdam from 2012 to 2016, but in a Periscope livestream that George Webb did with Jason Goodman in 2017, George Webb said that he used to "do drops" for Dutch intelligence: "(10:45) So, let me - I was talking about Mossad earlier. So, so, I didn't know that these people that were presenting themselves - little bit at a time - 'Oh, I'm just a diplomat. Oh, I'm just actually, uh, well, actually I had some intelligence background way back when. Oh, actually, um, I did a few operations. Oh, well, I might still do occasional stuff for blah blah blah. Oh, yeah, actually I am French intel.' That kinda procedure. And this happened to me with the Dutch. And now I'm just - I'm gonna let everybody know right now, I used to work with the Dutch. So it wasn't Russia. And I did drops." (https://www.pscp.tv/w/a_x8cDFEWUtYa0RwcWRwUWd8MXluS09qV3B3QlZ4UvjvMvixyqHi5E7VGH9t5zF4ulqSFK4NNYOqsMyKHhmr, https://www.reddit.com/r/conspiracy/comments/6ea5jp/wtf_is_george_webb_working_for_mossad_israeli/)
In a Twitch stream in February, JC said that he's trying to get RFK to stop focusing on gain-of-function: "I am consulting for Robert F. Kennedy Jr. I am trying desperately for him to remove the gain-of-function focus of his book and change it to a focus on artificial and synthetic biology. He is frustrated with me continuously. And I have a three month contract that's gonna expire next month. I don't know if I'll be hired again, but I know I'm not gonna change my mind based on whether they're hiring me or not. Regardless of what people have told you. I tell him what he needs to hear based on what I learned when I studied with you. If he doesn't like it, well, he hangs up, I guess. I'm not pushing an agenda, like the DEFUSE proposal, like Beric did it, like Fauci did it. It's a giant web of people who did it. All of the people who are currently sustaining this model where there is a panoply of viruses waiting to assault the humankind, and that the only way out is a ever-evolving set of technologies called vaccination is absurd. And Geert Vanden Bossche is part of that absurdity. So many of these people are part of that absurdity. GigaOhm Biological is not. And I hope someday Robert F. Kennedy Jr. will not be." (https://www.twitch.tv/videos/1745793865?t=1h50m30s) The video was titled "The Emperor's New Virus: The Awakening is Happening" and it has now been deleted, but I didn't find it mirrored on other websites.
George Webb has been saying that everyone is looking in the wrong direction for gain-of-function labs, and that the real gain-of-function research takes place at a monkey lab on the 26th floor of the Erasmus MC in Rotterdam (https://twitter.com/RealGeorgeWebb1/status/1619697362133458945). In one video, George Webb said: "All the travel I've done all over the world, going to all these different labs and all these different places, and I can tell you the whole scientific community and the whole press community says the gain of function's being done here at the Erasmus Lab. I just told them straight out, that's where it is. If you're talking about Pfizer, gain of function, you're wrong. They haven't done it. If you said Fort Detrick, I could tell you about that. If you said some monkey island in Sierra Leone, I could tell you about that. If you said it was at Emory, I could tell you about that. If you said it occurred in Reston, Virginia for the Hot Zone, I could tell you about that. I could tell you about all the leaks. The Marburg lab, I went to Germany, I went to the Marburg lab, I went to all these places. [...] I'm here to try to help you guys avoid a Hindenburg because right now you guys are steering the ship, the guided missile at an innocent party, right? You may think you're targeting with the nuclear missile. You may think you're targeting the right person, but you're off-target. You need to aim at this lab, at the 26th floor. I went to Rotterdam and I pointed to the 26th floor with the monkey lab where they were doing that, gain of function, and I told them where it was." (https://www.twitch.tv/videos/1725989891?t=2h42m28s)
Now it might be a coincidence that JC tells everybody that gain-of-function research is a distraction, but he used to work for an institute which according to Webb is a main center of gain-of-function research. In another stream, JC even said that "If you're not calling a pandemic virus bullsh*t, if you're not calling gain-of-function through serial passage or animal passage bullsh*t, then you're not on our team." (https://rumble.com/v28bpxi-giga-spiral.html, time 3:13:32)
Alex Jones keeps saying that the globalists keep trying to recruit him to their side, like that one time he traveled to New York to meet with the head of Kissinger Associates who invited him to join their side but he refused, and Alex keeps saying that he has received offers to join secret Illuminati parties but he always refused. Even though actually he's probably going to DUMBs to sacrifice kids to Xenu with George Soros. I was reminded of it when in a video in February titled "Study Hall: Andrew Huff on Highwire!?", JC was talking about how Andrew Huff is probably controlled opposition but then JC said that "I've been offered some weird opportunities that I've never followed through with": "And that's again why I think we have to use the utmost scrutiny and the utmost skepticism when approaching someone who purports to be outing the entire US government and the entire US intelligence apparatus. And at the same time also, I guess, outing China or something. I don't know, it's strange and we've got to be very careful because I don't think we can take him at his word. Whatever it is, he could be mostly a good guy, just like Robert Malone might mostly be a good guy. But is the husband of your friend who occasionally cheats but is otherwise a great guy - I mean, is he really good guy? You know, I mean, that's what I think we're dealing with here - is people that are willing to lie very consistently and precisely about things in order to advance their personal position in the invisible hierarchy that is at play. And I have not - I have been offered some weird opportunities that I've never followed through with. And I wonder if some of these other people have just been offered these opportunities and followed through with them." (https://www.twitch.tv/videos/1727033554?t=48m52s)
Around last December, JC changed the focus of his Twitch streams so that he began pushing his new clone theory, he started saying that gain-of-function research is not that dangerous and viruses cannot cause pandemics, he started streaming videos by no-virus people like Kaufman and Cowan and Massey, and he said that he no longer wants to talk to Rixey or McCairn. Around the same time JC seems to have gained a lot of traction in the more mainstream parts of alt media. JC's long-time followers have suspected that his change of focus might have something to do with how he's now a paid consultant for CHD. Rixey said that JC received a monthly salary of 7,000 USD from CHD and another source said it was 5,000 USD.
The reference genome of MERS is called HCoV-EMC/2012, where EMC stands for Erasmus Medical Center (https://www.ncbi.nlm.nih.gov/nuccore/667489388). MERS was first described in a paper titled "Isolation of a Novel Coronavirus from a Man with Pneumonia in Saudi Arabia" where the last author was Ron Fouchier, and four out of the five authors of the paper were listed as being affiliated with the Erasmus Medical Center. Two weeks later, the genome of MERS was further described in a paper titled "Genomic Characterization of a Newly Discovered Coronavirus Associated with Acute Respiratory Distress Syndrome in Humans", where the last author was again Fouchier and most authors were affiliated with the Erasmus Medical Center. It's interesting that MERS was described by the team of Fouchier who is an expert on gain-of-function research.
Have you actually read the methods in the paper Isolation of a Novel Coronavirus from a Man with Pneumonia in Saudi Arabia? It's the usual monkey cell nonsense and made-up "genome" lol. Nothing purified, no valid independent variable for use in a scientific experiment. Just nonsense.
Jay doesn't seem very sincere, given that he is still pushing "viruses" himself lol. And it's pretty amazing that he complained of people "sustaining this model where there is a panoply of viruses", while at the same time he continually trashes the no-virus people who exposed the fraud of virology. We're "dangerous", according to him. He never credits them with showing how retarded "isolation" and "sequencing" has been.
No one has ever shown gain-of-function experiments on avian influenza virus or any other virus, because none have been shown to exist to gain function on. And no one has shown any synthetic versions either. There are no valid studies.
The existence of labs does not make them actual "gain of function" labs. Ask George Webb to cite a valid study lol.
When did Jay EVER stream a video by a no-virus person, except to trash them? Never.
Jay has been forced to acknowledge reality, and for that he shows nothing but contempt towards the no-virus movement... with the one exception of acknowledging the value of Mark Bailey's Farewell to Virology essay: https://drsambailey.com/a-farewell-to-virology-expert-edition/.
In a stream in December, JC said that "in a lot of ways Andrew Kaufman and Tom Cowan and Christine Massey are right" and that "I'm almost a no-virus guy": "(1:00:20) All the virology research that's out there is based on clones. And those clones do what they say they do. They're sequencable in a laboratory. They're able to create sequencable models in a laboratory. Those are not hoaxes. The hoax is that whatever they see in those models, whatever they cure in those models is something that reflects usefully on what happens in nature. And that's not true because of the purity with which they start. And so in a lot of ways Andrew Kaufman and Tom Cowan and Christine Massey are right. They haven't isolated this virus. Their sequencing methods aren't capable of it. It's an approximation, which when is created in a clone remake of it shows behavior in a dish that looks like infectuous behavior. [...] (1:09:04) And now I have come full circle after three years. It's December 2nd. We are three years into this fiasco. And I'm almost a no-virus guy - but I'm definitely not. I'm the guy who is claiming that my concept here - my hypothesis here - is actually capable of uniting the no-virus side with the no-vax side. It's capable of uniting the pre-pandemic anti-vax crew with the post-pandemic anti-vax crew."" (https://odysee.com/@GigaohmBiologicalBackup/gigaohm53)
In an interview that JC did with Geopolitics & Empire in December, he also said that the no-virus folks are right in a lot of ways, and he was basically saying that he came up with his new clone theory after he looked into what the no-virusers were saying about the isolation and sequencing of viruses: "And I think it was being challenged a number of times over the last two years to try and understand the group or the mindset that you mentioned earlier, which is this no-virus mindset. It's a large, actually a very umbrella term to describe people who are in any range of skeptical about allopathic medicine and the Western model of disease. It doesn't mean necessarily that you don't believe in the current child vaccine schedule. It could just mean that you believe that water has memory. It's a really amorphous group of people that inevitably somewhere along the line gets connected to completely ridiculous sites. And so for me, it was very difficult to grasp how it was that there were some people that were very sharp, that were on this no-virus side, that seemed to be able to apply a pretty sharp level of scrutiny to certain aspects of the pandemic, but then completely not to any - just willy-nilly discounting, you know, 60 years of biology to make their point or sell their book. And so I've, you know, I've had clashes or bumped heads with people on our side because I want to listen to them. I wanna understand what it is about their objections to the pandemic narrative that are okay and give them ground to stand on. And it was in exploring their interpretations of the isolation papers, their interpretations of the metasequencing papers that led me to start to think about and realize that, wow, so much of what we know about coronavirus is actually not done from wild harvested coronaviruses, but from sequences that were detected in the wild and then replicated in a DNA cloning technology form." (https://www.youtube.com/watch?v=3gozu5rexBA?t=4m19s)
I've been saying that JC, Sasha Latypova, Mike Yeadon, and Karen Kingston are neo-Duesbergians (https://planetwavesfm.substack.com/p/pfizers-former-chief-scientist-mike/comment/13910220). Duesberg said that HIV exists and that HIV has been isolated and sequenced but it's a harmless passenger virus which is not the cause of AIDS. In the same way the neo-Duesbergians say that SARS 2 exists but it is not pathogenic, but they say that SARS 2 is not that dangerous or it's not capable of sustaining a pandemic, and they say that COVID was caused by a release of synthetic cDNA clones (JC and Latypova), by nanoparticle bioweapons (Latypova and Kingston), by aerosolized bat vaccines (Kingston), or by some kind of a release of toxins (Latypova). However it's suspicious that Latypova, Yeadon, and Kingston are all linked to Pfizer. I think Latypova did her alt media debut when she was interviewed by Stew Peters and Jane Ruby in January 2022, which should be an instant red flag, and I think the second interview she did was with some Dutch guy and the third interview was with JC (https://twitter.com/search?q=until%3A2022-3-1%20%28sasha%20OR%20alexandra%29%20latypova). Last year Jane Ruby hosted a small conference at Palm Beach where the speakers consisted of Yeadon, Latypova, Kingston, and David Martin.
Ask Jay to cite a paper showing the existence of ANY THING, natural or manmade, fitting the definition of a virus. Did you notice that he failed to respond to even 1 of my recent emails? And that Latypova (and Hazan) went a pretty nutty when challenged to back up her "virus" claims? I'm almost afraid to see how Kingston might react.
Clear as mud, as usual. Is Jay so daft that he doesn't understand you can't clone something that you don't actually have to begin with? And that purification and valid scientific experiments are needed to show that something fits the definition of a virus? Apparently he is that daft.
And David Martin is now pushing that idea, that the original four were isolated in the mid '60s, and then inculcated in animals and engineered into entities which can be used as weapons. The people who *need* a virus present in order to push their interests will hang on to the virus as desperately as someone clinging from the outside on to a window sill of a place more than floors above the ground. Thanks, Christine, your body of work just keeps overwhelming the fakers.
June 4, 2023 Addendum:
Here is a timeline that I created a while back in response to some of Jay’s accusations about no-virus people:
True timeline and emails with CHD consultant, Jay Couey
https://www.fluoridefreepeel.ca/true-timeline-and-emails-with-chd-consultant-jay-couey/
Hi Christine - JJC recently made a presentation to quite a large audience at "Red Pill Expo Study Hall" (18 June). I've seen several substack commenters posting it so you may have seen it already. If not & if interested, see https://www.twitch.tv/videos/2175381494 His presentation begins around 18min mark (skip 1st 10 mins or so spent throwing ex-CHD colleagues under the bus). I must say I found it just as confusing as his previous presentations but you might find something of interest in it, one year on.
Hi Kerrylyn. I watched up to 1:08:25 and found him as incoherent and full of himself as ever. Still referencing "viruses" and putting no-virus people down, but fails to show where we are wrong about anything. Implies that the fake "virus isolation" cell cultures demonstrate transfection, when the virologists simply observe cells breaking down and pretend that is evidence of a virus. Makes it sound like we have "only" addressed some of the fake "virus" evidence. I bet very few people in the audience would be able to accurately explain in their own words what his claims are other than "I'm the smartest and most honest and no one will listen to me and there's something wrong with everyone else".
Great work Christine. I watched the video with yourself, Dr Tom Cowan, Dr Andrew Kaufman, Alec Zeck and Dr Mark Bailey and the discussion around JJ Couey and mischaracterization and was taken aback at his extremely childish responses.
Waving about x-number papers and claiming 40 years of studies as his evidence is astounding. He ignores the fact that as was pointed out by Professor John Ioannidis paper "Why Most Published Research Findings are False".
Many papers simply use references from previous studies as evidence and we know that the measles study by Enders did not follow what we know as the scientific method. Dr. Stefan Lanka showed it to be so.
If the research or experiment has no controls it is false. He, Couey as a biologist should be aware of that. It's a basic fundamental
Slightly off topic, but I saw the best no virus talking point yesterday. Apparently, people who were vaccinated last year for Monkeypox in Chicago are having something of a relapse epidemic. So Monkeypox uses the oldest of old school of vaccines: live Vaccinia/Cow Pox. One brand, ACAM2000, is very old school, and is still cut into your arm, the other brand, Janeos, is injected, like flu/MMR/coof etc. The records of the last 600 years (remember, Jenner started the switch to Vaccinia/vaccination in 1790s, but direct Smallpox inoculation is over a millenia old and began in Europe in ernest in late 1500s/early 1600s), these records, clearly showed many did not buy the innoculation/vaccination theater and from the start said it does not prevent infection, but actually spured outbreaks, and caused the disease. Well, now we see the centuries derided naysayers appear correct. If the God of vaccine theater, Vaccinia, is a dud, they have nothing. Vaccinia is the key stone, and it is just plaster of paris. If you can pull people like Couey off of mRNA and make him explain why Vaccinia is a real thing but also a trick, maybe he will fully wake up. As long as people can talk about new, faulty vaccines, they have squiggle room. This takes the convo back to first principles, all vaccines are nonsense, many are not harmless, and they can't work because there is no there there.
To Christine and her CAPABLE readers:
I am placing this message here at the top of your comments section so it actually gets VIEWED and by the greatest number of people. The "drama" of the last few days is an example of what can happen when an anonymous online IDIOT decides he's a freakin' KNOW-IT-ALL and he knows more about historical events or movements than an OBVIOUS veteran who WAS ACTUALLY FREAKIN' THERE! I took great pains to offer the documentation that we made concerning much of what transpired in our dear old, NOW-DESTROYED "AIDS" dissident movement which we posted at the following link:
https://tig.org.za/RA.htm
ONE GOOD THING that has arisen out of all of these misinterpretations and misunderstandings is that the persistent IGNORANCE of one of Christine's commenters here has permitted me the opportunity to explain and RE-EXPLAIN for you readers what actually happened in and to our old "AIDS" dissident movement. As anyone can see who is NOT burdened by reading comprehension deficiencies and who takes the time to read the above link, there are NUMEROUS allegations we made (along with proof from e-mails from --and actions taken by- Duesberg and his "THUGS") that there WERE INDEED many acts of suppression and censorship perpetrated by the Duesberg faction against Eleni Papadopulos-Eleopulos and her "Perth Group" of dissenting "AIDS" researchers.
These included e-mails from Celia Farber in CELIA'S own words which Celia CHOSE to use in MANY e-mails that she CHOSE to send (many of which I STILL HAVE). The confusion around Celia's role may stem from the fact that she proved to be a very useful idiot for the Duesberg Cabal, but I get the feeling that Farber was not always involved in the "Cabal's" plans. Celia was more of an incessant cheerleader --and she still is to this day-- for her hero and "Daddy figure" Peter Duesberg. Celia's e-mails were directed both privately to smaller groups of individual supporters of the Perth Group (sometimes but not always including yours truly) as well as more publicly to VERY LARGE lists of e-mail recipients.
Much of this "civil war" was carried out semi-privately starting in 2008 via a large and varying (over time) list of e-mail recipients of HIGHER LEVER members of the "AIDS" dissident movement. I was considered --at least for these purposes-- one such "higher level" "AIDS" dissident who was "privileged" to be placed on the ever-changing recipients' list much of the time. Some exceptions were some private replies that were sent by Celia and others, many of which I have also received from third party recipients since then. There were several even more private e-mail threads, many "sub-discussions", that took place among even smaller groups of recipients. We certainly had many private discussions of our own that were also carried out via e-mail by a small group of us Perth Group supporters, including yours truly.
For a few months in 2009, the discussions and fights were also occurring on an old "Yahoo Groups" group, before DAVID CROWE threatened legal action (as he was WONT to do back then) against the owner of the Yahoo Group, and the owner then deleted ALL of our discussions! (See: http://www.tig.org.za/Paradigm%20posts.htm for some snippets from some of those deleted discussions).
At any rate, Celia Farber is absolutely LYING--(or suffering from early onset memory loss??)-- when she now claims that no one was ever trying to stop Eleni or the Perth Group or suppress the Perth Group's efforts! We have taken the time to document the histories of BOTH the original "Rethinking AIDS" group of which I WAS a small contributor (I copy-edited the old newsletters from the OLD, original "RA" group) AS WELL AS all the more unsavory history of the NEW, Rethinking AIDS "2.0" group that Duesberg and his cabal decided they needed to revive circa 2005 (with a lot of assistance from the always willing, dutiful and EAGER DAVID CROWE!).
Those histories are still available at the following link:
http://www.tig.org.za/History_of_Rethinking_AIDS_1.htm (follow all the way through from PART 1 to PART 6)
The opportunities for our old "AIDS" dissident movement in South Africa vis-a-vis President Mbkei's AIDS Advisory Panel were the greatest, most significant opportunities that ANY medical dissident movement EVER HAD! The history of what transpired and what did NOT transpire in South Africa is also documented at the histories #s1 through 6, available at the link above, and there are even more analyses at the following links:
http://www.tig.org.za/EPE_SEP14.pdf
and
http://www.tig.org.za/Bialy.pdf
and
http://www.tig.org.za/RA&RAConference&PGSep1609.pdf
I may comment later about the old exchanges in Continuum Magazine that took place between Duesberg and the Perth Group which Christine has referenced below. That "drama" that occurred in 1996-97 may need some clarification, too. However, that "event" was not only much older but, in my view, it was also actually much less injurious to the Perth Group and the "AIDS" dissident movement at large than the debacle that took place in South Africa in the early 2000s and all the subsequent Machiavellian acts of deceit that were perpetrated by the Duesberg cabal later on once they resuscitated the RA "2.0" group circa the mid 2000s.
BIG THANKS to those who actually LISTEN and those who aren't afraid to have their heroes questioned!
https://longtimedissident.substack.com/about
I don't know if you've seen the work of St. Nick: https://rumble.com/v1tz8bi-medical-anthropology-presentation-001.html, https://rumble.com/v1x5vi4-medical-anthropology-presentation-002.html, https://sites.google.com/antioch.edu/iatrogenic-timeline/home, https://www.zotero.org/foxsayswhat/collections/XNEMW2MW. He has been continuing Cantwell's line of investigation, and he even digitized some of Cantwell's research materials archived at the USC.
While AIDS dissidents were busy arguing if the Perth Group was right or Duesberg was right, no-one was reading Alan Cantwell or Len Horowitz or Ed Hooper. I didn't find references to any of them on your old website.
It's just like with COVID. We have people arguing if the no-virusers are right or if the no-virus-lite guys like JC are right, and no-one is reading Daoyu Zhang or Steve Massey or Istvan Csabai or Jesse Bloom or Sudhir Kumar.
If I wanted to create and release a virus which kills millions of people, a cunning scheme to throw dissidents off my track would be to insert one group of people into the dissident movement who say that my virus is fake, and to insert another group of people who say that my virus is real but not pathogenic, and to then waste everyone's time by staging a bunch of fights between those groups.
Three years ago Andrew Kaufman entered into alt media out of nowhere through flat earth channels, his first viral presentation was written, produced, and livestreamed by an ex-military Luciferian freemason flat earther, and his Hippocratic Hypocrisy film was narrated and produced by another flat earther who used to work for the pharma industry. A bunch of useful idiots followed, like for example Massey who said that she embarked on her FOIA crusade after she heard Kaufman's early presentations.
Duesberg said that HIV does not cause Kaposi's sarcoma, even though he used to work for the Special Virus Cancer Program whose purpose was to construct cancer-causing viruses.
Now in the past half a year, a faction of neo-Duesbergians has emerged who say that viruses are real but that SARS 2 is not the cause of COVID. Their leaders include Mike Yeadon who used to work for Pfizer and who worked at Porton Down under military clearance, Karen Kingston who used to work for Pfizer and who said that COVID vaccines contain hydras and snake venom, Sasha Latypova whose company iCardiac did a multimillion-dollar deal with Pfizer and who did her alt media debut on the Stew Peters Disinformation Network, and JC who wears a Mossad t-shirt.
Mike Yeadon has moved on from the idea of respiratory viruses, and once again the onus is on those who claim that such a thing, whether natural or manmade, exists.
Feel free to share your proof of any staged fights.
Dude whoever you are, you have no idea what you are talking about, and you are in WAY over your head, here! Your referring to Christine as a useful idiot has to be the most blatant example of PROJECTION I've seen in a very long time! I think Christine might feel compelled to reply to you, but in the meantime let me warn you by saying something she would probably say in this instance:
Whether we are referring to Anthony Fauci or Robert Gallo or Luc Montagnier or Alan Cantwell or Len Horowitz or Peter Duesberg or ...ahem.....YOU, the onus remains where it has always been:
The person claiming that there IS a virus, WHATEVER virus they are claiming exists, needs to show PROOF for said virus!
So.....show us PROOF of ANY FREAKIN' virus already!
I have already shown the proof to Massey many times, but she has always refused to follow my instructions and she just replies with something about "in silico" or "unknown provenance" or "particles". If you have some basic coding skills, an easy way to learn more about virology is to learn how to do bioinformatic analysis of viruses. You can get started by running the shell and R code in this file: https://cdn.discordapp.com/attachments/1093243194231246934/1103852719355211887/sars.html. Once you learn enough about virology, you'll learn that viruses are real. Doing FOIA requests clearly isn't an efficient way to learn about virology if Massey still believes that viruses do not exist after doing over 200 FOIA requests.
Sorry, but you are really quite ignorant and gullible - so you think that if you take nucleodite sequences from dead cells and string them together, you will get a fictitious virus...? It's will nevertheless always remain only a string of nucleotide sequences of excreted cell debris!!! Apparently you are not aware of why and especially what really makes people sick!!!
https://maryann255.substack.com/p/the-truth-is-always-on-the-other-66c
https://maryann255.substack.com/p/the-truth-is-always-on-the-other-228
And this is a completely natural procedure to keep the organism alive and healthy - why do you think that it is always necessary to ensure babies and small children sufficient sleep - because cell division takes place in rest/sleep and they need this to promote growth and health!!!
Why do you want to drag logically thinking people again and again into this tissue of lies??? Do you get paid for it, or can you just not admit that you let yourself be lied to, manipulated and deceived over a long period of time to take these poisonous substances...? and did you possibly even get side effects.... well, then I suggest that you contact exactly those who are responsible for this and who lied to you and deceived you!!!
https://maryann255.substack.com/p/the-truth-is-always-on-the-other-20e
https://maryann255.substack.com/p/the-truth-is-always-on-the-other-01f
I opened the first post you linked. In your spreadsheet, you indicated that the reverse primers like ACGATTGTGCATCAGCTGA didn't match SARS 2. However the reverse primers attach to the reverse strand, so you have to reverse the primer sequence and flip A and T letters and flip C and G letters. So then for example TCAGCTGATGCACAATCGT ends up being identical to positions 13442-13460 in Wuhan-Hu-1.
Also in your spreadsheet you crossed out degenerate bases like the Y letter in AYCACATTGGCACCCGCAATCCTG, and you didn't specify if primers with degenerate bases matched SARS 2, even though Y matches either C or T, so the Y matches the T in ATCACATTGGCACCCGCAATCCTG, which is located between positions 28704 and 28727 in Wuhan-Hu-1.
You can use `seqkit locate` to search for the primers on both positive and negative strands, and you can add `-d` to include matches for degenerate bases:
curl 'https://eutils.ncbi.nlm.nih.gov/entrez/eutils/efetch.fcgi?db=nuccore&rettype=fasta&id=MN908947.3' >sars2.fa
curl https://pastebin.com/raw/e8a0ukeJ >primers
sed $'1d;s/\t/ - /;s/\t/ - /' primers|cut -f-2|while read l;do seqkit tab2fx<<<"$l"|seqkit locate -df- sars2.fa|awk '1;END{if(NR==1)print"\t"x"\tno match"}' "x=$l";done|sed '1!{/seqID/d}'|cut -f2-|column -ts$'\t'
I posted the output of the commands above here: https://pastebin.com/raw/qUsV2MDb.
The output shows that I was left with only six primer or probe sequences with no matches. Three of them were part of a primer set which was used as a control in a protocol by the US CDC and which targeted the human RNase P gene (https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7392423/).
Out of the remaining three sequences with no matches, two were the reverse primer and probe from a primer set which was meant to detect other SARS-related viruses and not just SARS 2: "Charite RdRP_SARSr Pan Sarbeco FAM-BBQ-650" (FAM-CCAGGTGGWACRTCATCMGGTGATGC-BBQ650) and "Charite RdRP_SARSr Reverse Primer" (CARATGTTAAASACACTATTAGCATA) (https://www.biosearchtech.com/charite-2019-ncov-bbq-650-probes-primers-valupanel-reagents). The reverse primer and probe match a bunch of other SARS-like viruses, which is their intended purpose:
curl -Lso sarslike.fa 'https://drive.google.com/uc?export=download&id=1j-YFiMYG4DkVKSget2fYW-gaJDy6NCkW'
seqkit seq -g sarslike.fa|tr ' ' _|seqkit locate -id -p CARATGTTAAASACACTATTAGCATA|cut -f1,3-|column -ts$'\t'
seqkit seq -g sarslike.fa|tr ' ' _|seqkit locate -id -p CCAGGTGGWACRTCATCMGGTGATGC|cut -f1,3-|column -ts$'\t'
Output: https://pastebin.com/raw/cL3ic5YP. The same primer set also includes a second probe which is meant to match only SARS 2 ("Charite RdRP_SARSr 2019-nCoV FAM-BBQ-650 Probe").
The sixth sequence with no match was the Japanese NIID_2019-nCOV_N_R2 primer which had one mismatch, because it should've been TGGCAGCTGTGTAGGTCAAC but actually it was TGGCAGCTGTGTAGGTCAAC. For some reason they originally used the correct primer but they later issued a correction which said that "the reverse primer (NIID_2019-nCOV_N_R2) sequence should be replaced with TGGCAGCTGTGTAGGTCAAC." (https://www.who.int/docs/default-source/coronaviruse/method-niid-20200123-2.pdf) I don't know if it was some kind of an error, because I didn't find any 100% match for the updated primer on BLAST. And in NextStrain's global subset of about 3,000 SARS 2 sequences, I didn't find a single sequence which matched the updated primer (https://docs.nextstrain.org/projects/ncov/en/latest/reference/remote_inputs.html#summary-of-available-genbank-open-files):
curl https://data.nextstrain.org/files/ncov/open/global/sequences.fasta.xz|gzip -dc>global.fa;seqkit locate -ip TGGCAGCTGTGTAGGTCAAC global.fa
nothing to do with a virus
"Once you learn enough about TOOTH FAIRIES, you'll learn that TOOTH FAIRIES are real."
He does this all the time, it's his thing.
Can you point out any articles where the Perth Group provided a detailed explanation of why they claim that the methods that are used to do genetic sequencing and assembly for viruses are not valid, or how they claim viral genomes are fabricated? Or have they provided an explanation for why the genomes of viruses appear to evolve over time so that different variants emerge in different parts of the world? Or have they published articles where they tried to use genetics software to assemble viral genomes themselves?
I didn't find anything by googling for things like "site:theperthgroup.com sequencing" or "site:tig.org.za sequencing". I can try to address their arguments, because I have already countered some of Stefan Lanka's arguments about genetic assembly in these two articles: https://output.jsbin.com/suwuxoy, https://drive.google.com/uc?export=download&id=1zdsOm3LvgBv5OdSVnxSdpAou6mv7WMrA.
The so-called "HIV-Virus" - the same scam
https://ncbi.nlm.nih.gov/pmc/articles/PMC265559/pdf/jcm00018-0056.pdf
Page 2 - enter each group of letters in BLAST
https://blast.ncbi.nlm.nih.gov/Blast.cgi?PAGE_TYPE=BlastSearch&BLAST_SPEC=OGP__9606__9558&LINK_LOC=blasthome
at Enter Query Sequence, scroll down to the blue box on the left, click on it and wait for the result.
And why did some people get sick:
The chemical bases of the various AIDS epidemics: recreational drugs, anti-viral chemotherapy and malnutrition - PETER DUESBERG, CLAUS KOEHNLEIN and DAVID RASNICK
https://www.duesberg.com/papers/chemical-bases.html?fbclid=IwAR0q-W33Gc35_Xzdi2wm_g4Wz7WJjRRTVnlReNTlp-DYYfRSArMecnEDVHI
most importantly, people died from a drug that should never have been issued for this - AZT/Zidovudine!!!
https://carter-heavy-industries.com/2021/05/25/fauci-aids-azt-fraud/
Show there's anything fitting the definition of a virus that needs sequencing?
Lots to take in.
i want to send you a link by email, the only way i know how as an elder, but can't find one
No problem Crystal, you can email me at cmssyc@gmail.com. Cheers.
It’s going to be difficult for JC to acknowledge he was wrong because he acted like such an asshole in presentations I saw. Had he been an intellectual researcher, and more importantly a graceful communicator, he would not now be in the position of strategizing on how to save face. Maybe he will apologize for some stupid/ offensive things he said. Maybe he will turn his anger upon the system that trained him. It seems he’s going through the process, thanks to you Christine and others who have made him reconsider his faith in virology.
Have you heard Jon Rappaport’s two podcasts on HIV/AIDS and Duesberg?
Jon should open those two for the public.
Why?
So that people could listen for free.
Yes, obviously. I meant what is in those podcasts that you think is so important.
In the first podcast of 20:26 duration Jon explains again his process to understand how HIV was not the cause of AIDS. This is the 1980s, before Jon understood there were no viruses. By the end of that podcast he compares Duesberg and Papadopulus and the Perth Group, HIV exists but it does not cause AIDS, versus HIV was never shown to exist.
In the second part, of 57:09, Jon addresses the issue of the division of the dissidence over the issue whether the non-existence of SARS-CoV-2 is the most important issue. This is compared with the nasty backstory of infighting in the AIDS dissidence. His tone is conciliatory.
Jon insists "this is a war" and (33:40) he says it is astonishing to have a war based on something that does not exist.
Then he talks about the problems of vaccines in general, and the people who have spoken about vaccines over the years.
Then he speaks against Rockefeller's germ theory. A marketing model.
"The failure of isolating SARS-CoV-2 virus is not only about that virus is about most if not all viruses. My strong inclination is that it affects all viruses."
Jon shares one comment in conversation by Barbara Starfield of Johns Hopkins: that researches need to look the body as a whole, and not what they were doing: disease-cause-treatment.
Diseases are not single entities with single causes, and this truth has to be kept hidden because it is damaging to the marketing plan and to the plan to control the populations.
Then Jon speaks about the unexplored area of the effects of the thoughts on the body, for health and disease.
Jon also criticizes the immune system as a faulty metaphor based on military language. "Let's not assume that the immune system is a thing, a military force." "let's contemplate all the things and processes together."
He ends the podcast repeating that Peter Duesberg is a hero, and a great figure in the history of counter-medicine.
This was published last Thursday 2nd of May, before the little fight we the commenters of this substack unfortunately had the on days 6, 7 and 8.
That man I was talking with comes from that nasty infighting of the past. We should focus on the solutions. Solutions, in the plural. Because this is not about our feelings, but against global fascism.
https://jonrappoport.substack.com/p/aids-covid-science-wars-podcast-1
https://jonrappoport.substack.com/p/aids-covid-science-wars-podcast-2
Thank you for the summary.
The division has been over whether or not SARS-CoV-2 has been shown to exist. Some insist it does, and some say that it doesn't matter for now (an absurd position to take).
Jon has been clear for a long time now: it has not been shown to exist. I hope he was clear about this in the podcast.
I've haven't, no.
Part two
https://r20.rs6.net/tn.jsp?f=001gQBQ4yQCXXyAfn6bHYti5YgnUkX8eLK3E9uW_8XeZJjGjlFqJI7uarw47R7A8Zub0Ml60JDHAqlHVvwXZXoCH_GiUj7vWS8yRNqdt9oMblDjmEMPlUg06uHnlbacuJGWXx80Z6rSnLZH2lucgIlj7LDJuKkD4RSGFiSGQvEfQJ01Z60iOjAVcTM24nLEs7XGhSFtx8pACOlSCQKGm580dA==&c=dRexM9d-kNjzu2vPpUhgN_mSqAgZQ_P1F8xifarPaen4FNojnkfC5Q==&ch=UkuLjf_jEaYp24E-N6jFCjhI9ghkQFf388cS7aEyKF1WEBNiDjeVUg==
https://r20.rs6.net/tn.jsp?f=001gQBQ4yQCXXyAfn6bHYti5YgnUkX8eLK3E9uW_8XeZJjGjlFqJI7uarw47R7A8ZubYw0QulXX7QUhgDDy2BVSDNSexHpbY6_N2IXAgLUx-bxfr2iP0X3Woq7XjlbKUrZOZ_Eu275NO4hLi8WjI_DZfUkMjRZ855Bj_zw-6cNkGPGcykcl2Sr6a7MsBYFI42vCWCeNV_C4XUfmPNvj868o-Q==&c=dRexM9d-kNjzu2vPpUhgN_mSqAgZQ_P1F8xifarPaen4FNojnkfC5Q==&ch=UkuLjf_jEaYp24E-N6jFCjhI9ghkQFf388cS7aEyKF1WEBNiDjeVUg==
Part one
A few months ago, I left a comment here on my take on Jay. I had never heard of him, was recommended him as someone who would win me back to yes virus. I watched one video interview of him from Dec 2022and, as I said here, he appeared to be a hot muddled mess, deeply in the throes of cognitive dissonance and ego fortification. Even then it was clear he truly no longer accepted yes virus, but he just couldn't quit it. He talked of virologists tricking themselves (as opposed to just being liars), he talked of viruses being ghosts (because if you want to convince me of imaginary things, use imaginary things!), and he said the reason you have to be yes virus is because the risk is too great if they really are real (i.e. the check for under bed monsters, to be safe, not sorry). Aside: there are no treatments for viruses, just the crude sympathetic magic warding ritual to make it pass you by, so actually, there is no benefit to calling it a virus instead of a demon infestation or just a bad day. My own switch was much easier and quick, like Yeadon's, but it helps to be ontologically flexible and to have no ego bonds or relationship bonds to yes virus. Plus, this really started for me back in the 90s with HIV, but I gave up on that, moved on, only tomrealize why having won back then was a critical lost opportunity that allowed 2020 (same cast of characters as HIV). I've since seen Jay taking on a lot of the "freedom hucksters" and my opinion of him softened. I think he will get here sooner rather than latter, so long as he doesn't fall in love with his clones idea and reattach his ego to the lie. Yes virus has only one objective, to maintain the vaccine death theater resource grab loosh farm that has been going on for 600 years. Just say no...virus.
"Just say no...virus." - love it!
Hi Christine,
I have already added another reply, this one to Jeff Sims so that I could further explain to HIM why I expanded my comments about Celia Farber in my reply to his message. It needs to be emphasized why ALL OF THIS NONSENSE and threatening posts on Celia's stack came about, like a nightmarish game of "whisper-down-the-alley" being played by presumably all adults! It was because a "newbie", Jeff Sims, revealed that Celia had apparently "unleashed" her "emotional outrage" on HIM! What was Jeff's "crime"? Questioning Jon Rappoport! As I keep recommending, Celia needs to be IGNORED! It is my understanding that YOU, Christine, witnessed similar "emotional outrage" from Farber, no...?? If anyone needs evidence from ME, I could post some of the old "love letters" that Celia sent me....?? LOL! Let me know! I'm just not sure that they are particularly appropriate for THIS comments section, and I might like to retain them for further purposes should the need arise.
Again...for anyone who is still unclear: this is about TAKING RESPONSIBILITY for one's past support of FLAWED science! (Remember: this IS a *SCIENTIFIC* issue!) As I have stated elsewhere, ALL of us old-time "AIDS" dissidents have supported the great and "respectable" Peter Duesberg for at least some length of time! This includes yours truly! Some of us learned, however, to STOP that support, and some of us came to that conclusion a LONG TIME ago (like DECADES ago, in fact)!
At any rate, as for "Cosmos" you can decide what to do about him. After all, it IS your substack. However, I hope you can see how he really does drag down the quality of comments on here! It is my understanding that there ARE settings that you can control pertaining to who you allow to post comments on your own content here on substack.
I am copying my new reply to Jeff below:
As for the comment below from "Cosmos":
"Cosmos" has already stated numerous times how stupid he is and how much more simply he needs things to be explained for HIM!! He has also demonstrated repeatedly how profoundly IGNORANT HE is of all of the pertinent facts being discussed here including these historical FACTS about our old "AIDS" dissident movement! I only expanded my comments about Celia so that Jeff would feel better about the emotional outrage that she felt she needed to unleash on HIM!
It is quite well known among our "no virus" faction that this is a VERY common occurrence where Celia unleashes her wrath on new AND old members of the "no virus" faction who dare to question HER heroes and their STUPID defense of virology! It's OBVIOUS to anyone who investigates her closely that Celia is INSANE!! I've been calling her that for YEARS and she's never tried to sue ME! (BIG HINT: if you do not want to be called insane, then you should not send people multiple private e-mails where you really SOUND INSANE! I could have- and perhaps SHOULD have-- pursued CYBERSTALKING charges against HER!)
Not only that but, as I tried to point out to all LITERATE readers in my earlier post, it is lesser known that, as Farber HERSELF has admitted, she was utterly SH*T on by HER heroes in our old "AIDS" dissident movement! Also, I NEVER claimed that she ever received one red CENT for her ill-advised and zealous defense of her "Daddy figure" Peter Duesberg!
Unlike "Cosmos", I have already stated numerous times who I am and have provided my own background which is ALWAYS available for ALL to see in my profile on here --- and it's IN MY OWN FREAKIN' REAL NAME!!
If "Cosmos" truly had any BALLS, he would REVEAL his OWN identity! If not, then he needs to kindly STFU!! If he refuses to reveal his identity, then he should leave the adults here ALONE and go bother his *8* subscribers if they can STAND HIM!
END OF MY NEW REPLY TO JEFF
Thanks Christine!
Rod Knoll
https://longtimedissident.substack.com/about
First, I told you about the settings, Rod.
Second, you suck at uppercase, bro. LOL!
Three, you have recycled your reply to my critical comment, that's shameless self-plagiarism. Not that I care, but just so you know.
Fourth, I bring a lot of life and comedy and healthy pushback to this great substack. You should go back to the archives and read everything, you would have a blast!
Fifth, I happen to be a paying member of this lovely substack, Rod. Not that this fact gives me any privilege, the owner can ban me any time she wants. Christine is a fair human being so she would give me a warning and a good explanation. I try to be the change I want to see in the world. I'm all kumbayah and flower power. If I'm asked politely to go to the corner to play with my lego nuke launcher and use my imagination, I will. But you should raise your level of argumentation, stop the stupid caps, and apologize to Celia, Jon and Peter.
Don't be a Jerkasaurus, Rod!
--
P.S. What is your astrological sign? Are you a virgo sun or ascending? I heard that maladjusted Virgos can be very irritating people.
But watching your abuse of uppercase letters, I think you are a Gemini with Mercury retrograde. Your natal Mercury is mocking you. You have to step up and show him who is boss!
Hello, Christine!
Rod Knoll has sent me this response, which he has deleted (why?)
I'll post it here so that everyone can see. (I will change his excessive use of uppercase letters to improve readability.)
Rod writes in response to this critical comment of mine: https://christinemasseyfois.substack.com/p/jay-couey-admits-no-virus-people/comment/15737465
Rod Knoll:
"You have already stated numerous times how stupid you are and how much more simply you need things to be explained for you!! You have demonstrated repeatedly how profoundly ignorant you are of all of the pertinent facts being discussed including these historical facts about our old "AIDS" dissident movement! I only expanded my comments about Celia so that Jeff would feel better about the emotional outrage that she felt she needed to unleash on him! It is quite well known among the "no virus" faction that this is a very common occurrence where Celia unleashes her wrath on people who dare to question her heroes! Unlike you, I have already stated numerous times who I am and have provided my own background which is always available for all to see in my profile on here --- and it's in my own beautiful real name!! Who in tarnation are you anyway???!! Care to reveal yourself, you astonishingly sagacious stranger??? If not, then kindly remain silent!! Hopefully this sentence is short enough for even you to understand: Leave the adults here alone! Go bother your eight subscribers if they can stand you."
----
I've also altered some of his minced words, for the sake of comedy.
I don't know what kind of emotional nightmare did Jeff Sims go through. Please, Jeff, tell me that story.
----
I've sent an email to Celia Farber after writing a comment on this on her stack. Since she is attacked, I wanted to know her side. This guy Rod was so weird. Celia seems motivated to defend.
I want to repeat that I agree with Jon Rappoport on the admonition to not eat our own. Fights can be fun, but let's focus on the real issue.
----
Also, since Rod asks who am I, I am only an internet commenter with a pseudonym and an interest in justice and learning what is happening and what can I do.
I often bring links and quotes from videos to learn more about our situation.
People who read my comments know that most of the time I encourage people to overcome helplessness and to take care of their own health and fight against the global tyranny. That's just me.
Rod seems distracted, sadly.
This man acts in a weird way, in my opinion.
---
update:
https://longtimedissident.substack.com/about
Rod Knoll's bio, for those interested.
I think we need to hire a Catholic priest to do an exorcism on all these folks who know the truth yet cling to falsehoods. Purge them of the cognitive dissonance that (some) viruses exist yet none ever proven to exist. Get them to come clean. Or maybe a specialized rehab facility for germ theory adherents who understand it is a lie.
lol Lynn :)
Those four "cv's" are like beer bottles lined up on the fence... They'll be shot offa there PDQ!
The LIGHT is at the end of the tunnel... We're birthing a New Humanity... HOLD FAST, Mom is working hard to get us there. ;)
I have to leave for work, but THIS IS GREAT NEWS. Thanks, CM!! xo
I will read up the whole post and stuff tonight when I get home.
YAY!
Have a great evening :)
I am a great example of skimming over something due to being in a hurry and failing to get the meat of it, thinking a dab of salad dressing was the meal... I should know better;
I apologize for that. I thought we had a convert... I keep thinking all this is going to fold and collapse in on itself like the Twin Towers... Now that I've given it a better look, it seems the Poseurs are trying to keep their cred, with more CYA-ing and tiptoeing around the actual issues and trying to be "innocent" until proven pathological.
I still think the non-existence of viruses is going to blow a HUGE hole in many, many things, and we should persevere.
So again, Thank You, CM, you're a gentlewoman and a scholar-- and an excellent Prize Fighter, too, I might add-- Ali would be proud.
Cheers :)
You, too! ^_^
Even RFKJr has privately admitted in emails that viruses don't exist but says he can't speak out on it. Don't have the link at hand but it was in one of Eric Coppolino's stack articles re: no virus debate & Eric has been all over the CHD/Bobby Jr. reluctance to go there for a couple of years now. Check him out.
https://planetwavesfm.substack.com/
That's not what RFK said, but he said: "I'm grateful for your courage and intellectual integrity. I have an open mind on this issue but no bandwidth to spend the time energy and credibility capital to personally investigate it. I feel the same way towards those people who passionately and knowledgeably argue that 9/11 is an inside job. It could be true. But there are opportunity costs in taking on this cause and I think diminishing returns to my overall effectiveness. I cannot right every wrong or expose every falsehood. I need to be strategic In choosing my battles. If you reflect, you will find that you do the same. I admire and encourage you but I must beg off on this war for the time being. I'm more likely to join if you get it nearer the goal line where the cost/returns ratio improves." (https://planetwavesfm.substack.com/p/why-is-robert-f-kennedy-jr-running)
About half of RFK's book "The Real Anthony Fauci" was about HIV, and RFK wrote extensively about Duesberg and he presented Duesberg's theory on AIDS. RFK also mentioned the Perth Group on two occasions:
> Among the most outspoken dissidents of the HIV orthodoxy are biologist Eleni Papadopulos and physician Val Turner of the Australian Perth Group. Papadopulos and Turner believe the particles Gallo identified as HIV are not even retroviruses, but rather are a class of cellular debris generated entirely from within the human body. Even Luc Montagnier admitted in an interview with the journal Continuum in 1997 that after 'Roman effort,' with electron micrographs of the cell culture, with which HIV was said to have been detected, no particles were visible with 'morphology typical of retroviruses.
> [...]
> Other respected scientists took Duesberg's doubts even further than Duesberg. Led by Dr. Eleni Papadopulos and Dr. Val Turner, The Perth Group in Australia argues that Gallo's claim was altogether specious and that neither Gallo nor Montagnier had ever succeeded in even isolating a discrete HIV.
> In my conversations with Turner and Papadopulos, and in my reading of their paper, I find their arguments clear and convincing. However, I recognize that there are some fifty thousand articles on AIDS in the scientific literature. A casual novitiate like myself has little chance of unraveling this baroque controversy in a vacuum. Without rigorous debate, the public and press must form opinions based upon appeals to authority - a feature of religion, not of democracy or science. Any debate on that battleground will always be won by self-interested government and industry officials who control the bullhorn and the media.
So it could be that RFK has not decided if he should believe Duesberg's camp or the Perth Group's camp. Duesberg said that HIV has been isolated and sequenced (http://duesberg.com/papers/continu1.html, http://duesberg.com/papers/continu2.html).
I didn't find any reference in RFK's book to Alan Cantwell or Len Horowitz, who say that HIV exists and is pathogenic and that HIV is a man-made bioweapon which was released deliberately (https://archive.org/details/For_The_Record_16_Interview_with_Leonard_Horowitz_Alan_Cantwell_Ed_Haslam_et_al/f-016a.mp3). There was no reference to Ed Hooper either, who wrote the book "The River" about how oral polio vaccines were employed to spread HIV in Africa (http://www.aidsorigins.com/the-river-a-journey-to-the-source-of-hiv-and-aids-2021-edition-by-edward-hooper/).
RFK's book was dedicated to "that battle-hardened cadre of heroic scientists and physicians who have risked their careers, their livelihoods, and their reputations to champion evidence-based science and ethical medicine", which included a total of 46 names. His list was followed by "The Heroic Healers Honor Roll" which featured both people from the no-virus camp (Tom Cowan) and people from the camp which claims that HIV exists but is not pathogenic (Peter Duesberg, David Rasnick, and Kary Mullis). I didn't find anyone from the camp of Cantwell and Horowitz though.
He basically admitted that he knows virology is rubbish. And that is not his only communication that is on record, plus there are comments from Mary Holland on record. They know.
RFK Jr. seems to feign ignorance in his book on Fauci where he definitely takes a more pro-Duesberg stance on the “HIV” issue. As Mongol pointed out, RFK justifies his stance by claiming that he is too much of a “casual novitiate” who “has little chance of unraveling this baroque controversy in a vacuum”, i.e., all the complex issues that were raised during our old “AIDS” dissident movement by the late Eleni Papadopulos-Eleopulos and the Perth Group of dissident “AIDS” researchers that she led ( http://theperthgroup.com ).
However, RFK Jr. also seems blissfully ignorant of the fact that it is not advisable to argue simultaneously-- as he DEFINITELY does in his book-- that, on the one hand, "neither Gallo nor Montagnier had ever succeeded in even isolating a discrete HIV" and on the other hand, that HIV is a virus which definitely exists but is a "harmless passenger virus". Of course, as you know, Duesberg's theory --which is like arguing that there are "toothless vampires"-- is demonstrably wrong on the science. However, it's also true that the two theories are CONTRADICTORY, like "oil and water". As an attorney, RFK Jr. SHOULD be smart enough to know that such a strategy would never work in any court case (See: http://www.tig.org.za/Legal%20strategy.pdf ).
Most likely, RFK Jr. is familiar with the real history of our old "AIDS" dissident movement (See: https://tig.org.za/RA.htm ). Unfortunately, as you know, we "AIDS" dissidents allowed these two aforementioned competing theories to co-exist in our old "AIDS" dissident movement. It didn't work! Our "AIDS" dissident movement proved to be a HUGE FAILURE, in large part because we allowed Duesberg and his supporters to continue in our movement for far too long (see also: https://tig.org.za/TIG_Position_Statement_on_HIV.htm ).
If RFK Jr. does know that virology is rubbish and he is familiar with the history from our old "AIDS" dissident movement, then the question remains: why is RFK Jr. repeating this same mistake of allowing two contradictory theories to co-exist?
Have you noticed that since genome sequencing and the advances in bioinformatics, they say "oh, well, we don't need to have a virus, we can just sequence that from a complex sample, and the Koch's postulates were never valid, we have better standards of proof and reasoning like the Bradford-Hill criteria"?
I think that is tailored to meet the rhetorical needs of politicians and PR people. The ambiguity and the air of the new thing takes over everything and the muggles put on the deer-in-headlights face.
If a politician needs to move this way a little, they can say something that rhymes with this scientific model. If the next day they need to move in a different direction, they can repeat some random phrase from a textbook. Everyone is happy.
They never have a valid independent variable to do any science with! And Bradford-Hill criteria cannot be applied to imaginary particles lol. And they can't even demonstrate contagion. Anyone who thinks that finding sequences somehow proves the existence of a "virus" needs their head examined. Or, they are just bamboozling people with fancy-sounding technology.
I used to think, before I read, that the magic soup was like a layered image in a picture editing software, where one can activate or deactivate layers of superimposed images, alter the blending method and the opacity, and so on.
So, I imagined (wrongly) that they can just use this antibiotic or this antifungal to hide interference from germs in the culture, to make sure that only the virus was doing something. And then, compare with a true negative control.
No such thing! LOL! It's all fake!
And after I learned that, it was easier to see the biggest (IMO) problem, the isolation and purification and further chemical characterization. That step is necessary. Computers cannot save that work. That's worse than cheating.
Much later, I learned they claim purification cannot be done because viruses are labile. That means when they try to filter them to get only the unicorns they decompose and they don't work. That means the whole concept is false! The virions cannot do what they say they do.
Or show that as the replicated infective particles lyse the cell they can make it to the next cell and not decompose in transit. How come viruses are not labile inside the living body? It's impossible.
LOL
I'm so obsessed with this stuff.
I have to laugh at myself.
Yes, thank you Christine. The private email & conversations I read in the stack were not the ones that Mongol wrote about above. Agree that both Mary & RFKJr are aware the proof that viruses do not exist is irrefutable but they are still dissembling.
In case Mongol isn't sure about my meaning here, dissembling means hypocritical; false, to conceal facts, intentions, or feelings under some pretense or putting on a false appearance. Bobby & his CHD organization are dissembling to stay in business so the naysayers won't call names & attack CHD's "integrity". So CHD lies instead.
I know all about it, Eric and I are friends and I've shared all his RFK Jr content :)
https://christinemasseyfois.substack.com/p/why-is-robert-f-kennedy-jr-running
In a Twitch stream on February 28th UTC titled "Study Hall--Robert Malone on London Real", JC wore a t-shirt which consisted of the logo of Mossad with the text "SINCE 1949" below the logo: https://i.ibb.co/2dx60BW/jonathan-jay-couey-twitch-1752154423-mossad-t-shirt-feb-28th-2023.jpg.
I don't think JC ever explained why he wore the t-shirt. It may have been to troll Kevin McCairn, who two days earlier did a stream about J. Bart Classen's paper which said that Mossad did COVID (https://rumble.com/v2b2zdo-world-war-shlomo-part-2-lab-leak-psy-op-classen-and-mossad-covid-klaus.html). At that point JC had been in a streaming war with McCairn for a few months after McCairn and Rixey called out his clone theory as nonsense. But why would JC have bought the Mossad t-shirt in the first place? What was the point of just wearing the t-shirt on a stream without ever explaining why he wore it?
JC's T-shirt was designed by Shlomo Cohen and it's part of a collection of designs which express love for the state of Israel (https://qumranshop.com/apparel/t-shirt-mossad-1949.html).
On a list of "DRASTIC's key breakthroughs and research" compiled by Charles Rixey, the first entry is that Dan and Karl Sirotkin co-authored a blog post about the lab leak theory which was published on January 31st 2020, and the second entry is that JC started posting YouTube videos about COVID in February 2020 (https://i.ibb.co/3yjWYNN/drastic-key-breakthroughs.png). Out of the videos that are currently visible on JC's YouTube channel, the very first video about COVID was a video about the blog post by Dan and Karl Sirotkin (https://www.youtube.com/@JConabike/videos).
Dan Sirotkin tweeted: "As half Askenazi Jew and half Cajun, I can't imagine how those white devils sleep at night!!" (https://twitter.com/Harvard2H/status/1425424404591284231). He also tweeted: "Wonder if us Jews get free bagels..." (https://twitter.com/Harvard2H/status/1222165786304880640) He also tweeted: "Where do I start with the quarter-to-three-quarter Jew privilege?" (https://twitter.com/Harvard2H/status/1298767738811318272) However he probably gets his Jewish ancestry from his father's side because he tweeted: "My last name means 'orphan' in both Ukrainian and Russian because my paternal great-great-grandfather had to be hidden in a Catholic orphanage in Gomel so he didn't end up as the Tsar's cannon-fodder, since he was a Jew." (https://twitter.com/Harvard2H/status/1603861877993476097) So his father Karl Sirotkin might be a full Jew.
Karl Sirotkin is a self-described "former NSA counterterrorism analyst" (https://harvardtothebighouse.com/2020/01/31/logistical-and-technical-analysis-of-the-origins-of-the-wuhan-coronavirus-2019-ncov/). So basically it's possible that DRASTIC started out with a blog post that was co-authored by a half-Jew and his fully Jewish father who was a counterterrorism analyst for the NSA.
On Rixey's list of DRASTIC's key breakthroughs, the 4th, 5th, 6th, and 7th entries are about work done by Yuri Deigin, but Deigin also posted a tweet where he said: "PS: for the record, I am against censorship. Even for Holocaust deniers. And I'm half Jewish." (https://twitter.com/ydeigin/status/1396928014454304770)
George Webb has been moving in the same circles as JC for three years now, and for example they were both doing videos with Addy Adds and the Jew Paul Cottrell early on, but George Webb has said that he has homies at French Mossad: "(0:09) All my French Mossad homies want me to do a shout out to Francis Cabrel. [...] It's just the spycraft and the beauty of how Mossad does shit. You know, I just - especially the French Mossad is just really fantastic spycraft. And really the antecedents of that go all the way back to World War 2. This is when they were working with OSS - and I've said this before - they would have these radio shows at night where they would do different songs, play different songs, and the songs were encoded. Certain songs would mean blow up the local railroad. Thanks Mossad homies and [something Français?] because you've helped me out so much in this. [...] (1:00) One of the things that's been so hard for me in this series is playing the Mossad thing. Because so many people have come out against Mossad and how evil Mossad is and so forth. [...] (1:14) So that's - I'm always rooting for Mossad secretly kind of. And this is what that is. [...] (1:35) My sources, and I'm - you saw French Mossad today, you know, give me some stuff. [...] (2:54) And then there's the great Mossad, which was fundamental to the survival of Israel. I know people are going to say we did a lot of stuff. And you know with the Lebanese babies and the Yemeni babies and Palestine and - I'm not getting into that, I don't want to get into that, organ harvesting and all this. We can do business the old way, we still make a lot of money, make everybody happy, make movies, whatever we do. [...] (4:37) I do have [unintelligible] ties with Israel. [...] And I'm with the old guard. You know, the Negev Brigade, and Ben-Gurion, and Avi Braverman." (https://www.youtube.com/watch?v=dKBC3gChmKQ)
JC worked as a research scientist at the Erasmus Medical Center in Rotterdam from 2012 to 2016, but in a Periscope livestream that George Webb did with Jason Goodman in 2017, George Webb said that he used to "do drops" for Dutch intelligence: "(10:45) So, let me - I was talking about Mossad earlier. So, so, I didn't know that these people that were presenting themselves - little bit at a time - 'Oh, I'm just a diplomat. Oh, I'm just actually, uh, well, actually I had some intelligence background way back when. Oh, actually, um, I did a few operations. Oh, well, I might still do occasional stuff for blah blah blah. Oh, yeah, actually I am French intel.' That kinda procedure. And this happened to me with the Dutch. And now I'm just - I'm gonna let everybody know right now, I used to work with the Dutch. So it wasn't Russia. And I did drops." (https://www.pscp.tv/w/a_x8cDFEWUtYa0RwcWRwUWd8MXluS09qV3B3QlZ4UvjvMvixyqHi5E7VGH9t5zF4ulqSFK4NNYOqsMyKHhmr, https://www.reddit.com/r/conspiracy/comments/6ea5jp/wtf_is_george_webb_working_for_mossad_israeli/)
In a YouTube video titled "Day 214.7. Hillary's Leakers and Hackers", George Webb admitted that he was a Jew: "I'm not Republican or a Democrat, I'm a Berniecrat - but anyway - and Jewish, so that's - I'm always rooting for Mossad, secretly, kind of. And this is what that is." (https://steemit.com/news/@defango/george-webb-and-this-mossad-homies, https://streamable.com/mm6v3)
In a Twitch stream in February, JC said that he's trying to get RFK to stop focusing on gain-of-function: "I am consulting for Robert F. Kennedy Jr. I am trying desperately for him to remove the gain-of-function focus of his book and change it to a focus on artificial and synthetic biology. He is frustrated with me continuously. And I have a three month contract that's gonna expire next month. I don't know if I'll be hired again, but I know I'm not gonna change my mind based on whether they're hiring me or not. Regardless of what people have told you. I tell him what he needs to hear based on what I learned when I studied with you. If he doesn't like it, well, he hangs up, I guess. I'm not pushing an agenda, like the DEFUSE proposal, like Beric did it, like Fauci did it. It's a giant web of people who did it. All of the people who are currently sustaining this model where there is a panoply of viruses waiting to assault the humankind, and that the only way out is a ever-evolving set of technologies called vaccination is absurd. And Geert Vanden Bossche is part of that absurdity. So many of these people are part of that absurdity. GigaOhm Biological is not. And I hope someday Robert F. Kennedy Jr. will not be." (https://www.twitch.tv/videos/1745793865?t=1h50m30s) The video was titled "The Emperor's New Virus: The Awakening is Happening" and it has now been deleted, but I didn't find it mirrored on other websites.
JC's LinkedIn profile says that from 2012 to 2016, he worked as a research scientist at the Erasmus Medical Center in Rotterdam (https://www.linkedin.com/in/jonathan-couey-a20a1383/). The deputy head of Erasmus MC's department of viroscience is Ron Fouchier. He led one of the most famous publicly acknowledged gain-of-function experiments, where the H5N1 avian influenza was serial passaged in ferrets which made it adapted to mammalian lungs and allowed it to be transmitted through respiratory droplets (https://en.wikipedia.org/wiki/Gain-of-function_research#Experiments_that_have_been_referred_to_as_%22gain-of-function%22). In 2013, Science published a letter titled "Gain-of-Function Experiments on H7N9" whose first author was Fouchier (https://www.science.org/doi/full/10.1126/science.1243325). Fouchier was also one of the authors of a letter published by Nature titled "Gain-of-function experiments: time for a real debate" (https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7097416/).
George Webb has been saying that everyone is looking in the wrong direction for gain-of-function labs, and that the real gain-of-function research takes place at a monkey lab on the 26th floor of the Erasmus MC in Rotterdam (https://twitter.com/RealGeorgeWebb1/status/1619697362133458945). In one video, George Webb said: "All the travel I've done all over the world, going to all these different labs and all these different places, and I can tell you the whole scientific community and the whole press community says the gain of function's being done here at the Erasmus Lab. I just told them straight out, that's where it is. If you're talking about Pfizer, gain of function, you're wrong. They haven't done it. If you said Fort Detrick, I could tell you about that. If you said some monkey island in Sierra Leone, I could tell you about that. If you said it was at Emory, I could tell you about that. If you said it occurred in Reston, Virginia for the Hot Zone, I could tell you about that. I could tell you about all the leaks. The Marburg lab, I went to Germany, I went to the Marburg lab, I went to all these places. [...] I'm here to try to help you guys avoid a Hindenburg because right now you guys are steering the ship, the guided missile at an innocent party, right? You may think you're targeting with the nuclear missile. You may think you're targeting the right person, but you're off-target. You need to aim at this lab, at the 26th floor. I went to Rotterdam and I pointed to the 26th floor with the monkey lab where they were doing that, gain of function, and I told them where it was." (https://www.twitch.tv/videos/1725989891?t=2h42m28s)
Now it might be a coincidence that JC tells everybody that gain-of-function research is a distraction, but he used to work for an institute which according to Webb is a main center of gain-of-function research. In another stream, JC even said that "If you're not calling a pandemic virus bullsh*t, if you're not calling gain-of-function through serial passage or animal passage bullsh*t, then you're not on our team." (https://rumble.com/v28bpxi-giga-spiral.html, time 3:13:32)
Alex Jones keeps saying that the globalists keep trying to recruit him to their side, like that one time he traveled to New York to meet with the head of Kissinger Associates who invited him to join their side but he refused, and Alex keeps saying that he has received offers to join secret Illuminati parties but he always refused. Even though actually he's probably going to DUMBs to sacrifice kids to Xenu with George Soros. I was reminded of it when in a video in February titled "Study Hall: Andrew Huff on Highwire!?", JC was talking about how Andrew Huff is probably controlled opposition but then JC said that "I've been offered some weird opportunities that I've never followed through with": "And that's again why I think we have to use the utmost scrutiny and the utmost skepticism when approaching someone who purports to be outing the entire US government and the entire US intelligence apparatus. And at the same time also, I guess, outing China or something. I don't know, it's strange and we've got to be very careful because I don't think we can take him at his word. Whatever it is, he could be mostly a good guy, just like Robert Malone might mostly be a good guy. But is the husband of your friend who occasionally cheats but is otherwise a great guy - I mean, is he really good guy? You know, I mean, that's what I think we're dealing with here - is people that are willing to lie very consistently and precisely about things in order to advance their personal position in the invisible hierarchy that is at play. And I have not - I have been offered some weird opportunities that I've never followed through with. And I wonder if some of these other people have just been offered these opportunities and followed through with them." (https://www.twitch.tv/videos/1727033554?t=48m52s)
Around last December, JC changed the focus of his Twitch streams so that he began pushing his new clone theory, he started saying that gain-of-function research is not that dangerous and viruses cannot cause pandemics, he started streaming videos by no-virus people like Kaufman and Cowan and Massey, and he said that he no longer wants to talk to Rixey or McCairn. Around the same time JC seems to have gained a lot of traction in the more mainstream parts of alt media. JC's long-time followers have suspected that his change of focus might have something to do with how he's now a paid consultant for CHD. Rixey said that JC received a monthly salary of 7,000 USD from CHD and another source said it was 5,000 USD.
The reference genome of MERS is called HCoV-EMC/2012, where EMC stands for Erasmus Medical Center (https://www.ncbi.nlm.nih.gov/nuccore/667489388). MERS was first described in a paper titled "Isolation of a Novel Coronavirus from a Man with Pneumonia in Saudi Arabia" where the last author was Ron Fouchier, and four out of the five authors of the paper were listed as being affiliated with the Erasmus Medical Center. Two weeks later, the genome of MERS was further described in a paper titled "Genomic Characterization of a Newly Discovered Coronavirus Associated with Acute Respiratory Distress Syndrome in Humans", where the last author was again Fouchier and most authors were affiliated with the Erasmus Medical Center. It's interesting that MERS was described by the team of Fouchier who is an expert on gain-of-function research.
Have you actually read the methods in the paper Isolation of a Novel Coronavirus from a Man with Pneumonia in Saudi Arabia? It's the usual monkey cell nonsense and made-up "genome" lol. Nothing purified, no valid independent variable for use in a scientific experiment. Just nonsense.
https://www.nejm.org/doi/full/10.1056/NEJMoa1211721
Jay doesn't seem very sincere, given that he is still pushing "viruses" himself lol. And it's pretty amazing that he complained of people "sustaining this model where there is a panoply of viruses", while at the same time he continually trashes the no-virus people who exposed the fraud of virology. We're "dangerous", according to him. He never credits them with showing how retarded "isolation" and "sequencing" has been.
No one has ever shown gain-of-function experiments on avian influenza virus or any other virus, because none have been shown to exist to gain function on. And no one has shown any synthetic versions either. There are no valid studies.
The existence of labs does not make them actual "gain of function" labs. Ask George Webb to cite a valid study lol.
When did Jay EVER stream a video by a no-virus person, except to trash them? Never.
Jay has been forced to acknowledge reality, and for that he shows nothing but contempt towards the no-virus movement... with the one exception of acknowledging the value of Mark Bailey's Farewell to Virology essay: https://drsambailey.com/a-farewell-to-virology-expert-edition/.
In a stream in December, JC said that "in a lot of ways Andrew Kaufman and Tom Cowan and Christine Massey are right" and that "I'm almost a no-virus guy": "(1:00:20) All the virology research that's out there is based on clones. And those clones do what they say they do. They're sequencable in a laboratory. They're able to create sequencable models in a laboratory. Those are not hoaxes. The hoax is that whatever they see in those models, whatever they cure in those models is something that reflects usefully on what happens in nature. And that's not true because of the purity with which they start. And so in a lot of ways Andrew Kaufman and Tom Cowan and Christine Massey are right. They haven't isolated this virus. Their sequencing methods aren't capable of it. It's an approximation, which when is created in a clone remake of it shows behavior in a dish that looks like infectuous behavior. [...] (1:09:04) And now I have come full circle after three years. It's December 2nd. We are three years into this fiasco. And I'm almost a no-virus guy - but I'm definitely not. I'm the guy who is claiming that my concept here - my hypothesis here - is actually capable of uniting the no-virus side with the no-vax side. It's capable of uniting the pre-pandemic anti-vax crew with the post-pandemic anti-vax crew."" (https://odysee.com/@GigaohmBiologicalBackup/gigaohm53)
In an interview that JC did with Geopolitics & Empire in December, he also said that the no-virus folks are right in a lot of ways, and he was basically saying that he came up with his new clone theory after he looked into what the no-virusers were saying about the isolation and sequencing of viruses: "And I think it was being challenged a number of times over the last two years to try and understand the group or the mindset that you mentioned earlier, which is this no-virus mindset. It's a large, actually a very umbrella term to describe people who are in any range of skeptical about allopathic medicine and the Western model of disease. It doesn't mean necessarily that you don't believe in the current child vaccine schedule. It could just mean that you believe that water has memory. It's a really amorphous group of people that inevitably somewhere along the line gets connected to completely ridiculous sites. And so for me, it was very difficult to grasp how it was that there were some people that were very sharp, that were on this no-virus side, that seemed to be able to apply a pretty sharp level of scrutiny to certain aspects of the pandemic, but then completely not to any - just willy-nilly discounting, you know, 60 years of biology to make their point or sell their book. And so I've, you know, I've had clashes or bumped heads with people on our side because I want to listen to them. I wanna understand what it is about their objections to the pandemic narrative that are okay and give them ground to stand on. And it was in exploring their interpretations of the isolation papers, their interpretations of the metasequencing papers that led me to start to think about and realize that, wow, so much of what we know about coronavirus is actually not done from wild harvested coronaviruses, but from sequences that were detected in the wild and then replicated in a DNA cloning technology form." (https://www.youtube.com/watch?v=3gozu5rexBA?t=4m19s)
I've been saying that JC, Sasha Latypova, Mike Yeadon, and Karen Kingston are neo-Duesbergians (https://planetwavesfm.substack.com/p/pfizers-former-chief-scientist-mike/comment/13910220). Duesberg said that HIV exists and that HIV has been isolated and sequenced but it's a harmless passenger virus which is not the cause of AIDS. In the same way the neo-Duesbergians say that SARS 2 exists but it is not pathogenic, but they say that SARS 2 is not that dangerous or it's not capable of sustaining a pandemic, and they say that COVID was caused by a release of synthetic cDNA clones (JC and Latypova), by nanoparticle bioweapons (Latypova and Kingston), by aerosolized bat vaccines (Kingston), or by some kind of a release of toxins (Latypova). However it's suspicious that Latypova, Yeadon, and Kingston are all linked to Pfizer. I think Latypova did her alt media debut when she was interviewed by Stew Peters and Jane Ruby in January 2022, which should be an instant red flag, and I think the second interview she did was with some Dutch guy and the third interview was with JC (https://twitter.com/search?q=until%3A2022-3-1%20%28sasha%20OR%20alexandra%29%20latypova). Last year Jane Ruby hosted a small conference at Palm Beach where the speakers consisted of Yeadon, Latypova, Kingston, and David Martin.
Jane Ruby is a hardcore Zionist Jew who said that Palestinians are cockroaches, that Palestine is a hoax, and that Obama was a traitor because his administration abstained from voting against an anti-Israel UN resolution (https://twitter.com/search?q=from%3Arealdrjaneruby+%28israel+OR+palestine%29+until%3A2017-1-1&src=typed_query&f=live).
Ask Jay to cite a paper showing the existence of ANY THING, natural or manmade, fitting the definition of a virus. Did you notice that he failed to respond to even 1 of my recent emails? And that Latypova (and Hazan) went a pretty nutty when challenged to back up her "virus" claims? I'm almost afraid to see how Kingston might react.
Clear as mud, as usual. Is Jay so daft that he doesn't understand you can't clone something that you don't actually have to begin with? And that purification and valid scientific experiments are needed to show that something fits the definition of a virus? Apparently he is that daft.
And David Martin is now pushing that idea, that the original four were isolated in the mid '60s, and then inculcated in animals and engineered into entities which can be used as weapons. The people who *need* a virus present in order to push their interests will hang on to the virus as desperately as someone clinging from the outside on to a window sill of a place more than floors above the ground. Thanks, Christine, your body of work just keeps overwhelming the fakers.