I think DelBigtree's argument is ridiculous, the fact viruses are not pathogenic sars cov2 never existed is much more important than the faked origin. Who cares about the origin {WHO would} if the world learns it was all based on fraud, a plan and not a pandemic would allow them to get away with it?
Now is the time, not later, anyone who's thinking now they will pull another one out of their hat.
Isn't it awful enough that they've conned billions into believing in long covid.
In fact the time was at least 3 yrs ago when the governmental, WHO UN. Rockefeller & co's lockstep began.
Imagine grown popular men with large followings & website like Del, RFK who were /are purportedly against the injuring and mandating of vaccines to children for their pleasure for being in institutions which are not even educating them. 12 yrs spent to be indoctrinated into becoming global citizens who follow the rules, don't question.
I can't fathom how these men or their fellows never once did any research to see if vaccines where ever required, if the germ theory had it right, being against the poisons which never saved anyone, is after all not a new phenomena.
Hmm.
In any case I'm glad to hear that you and your friend have good news on the false criminal "charges" against you both. Thank you for your diligence and all the additional information on this post.
Cheers, Mia
P.s Christine, I wonder have you, heard of the Report from Iron Mountain?
Hi Christine, this is not related to this excellent article but I can’t think of any other way to contact you (are you still banned from Twitter?).
I just read a Substack article by Martin Neil, Where Are The Numbers and in the comments someone (Geoff Pain) said: “The first isolation and full characterization of the Wuhan Covid 19 was done in Melbourne, Victoria, Australia in January 2020. It was isolated, examined by Transmission Electron Microscopy and confirmed to a Coronavirus by PCR, then full Sequencing, then successful Culture and Export.
Caly et al. (2020), "Isolation and rapid sharing of the 2019 novel coronavirus (SARS-CoV-2) from the first patient diagnosed with COVID-19 in Australia." DOI: 10.5694/mja2.50569
I notice that the like button on substack are still very bouncy! I've just liked the same comment THREE TIMES before it would stick. I might have to check back later to see if it has vanished AGAIN.
Even if Del can't admit there's no virus, I wish he'd hammer home the obvious point that there is no TEST for this virus. And it hasn't been proven that "the virus" causes "those symptoms". If he could just completely debunk the use of PCR as a diagnostic tool, that would be a huge step in the right direction. They're still talking (in the mainstream news) about using it to test wastewater for Covid particles. That would easily be a justification for locking us all down again.
Del Bigtree is deceiving and manipulating his viewership. Disgusting. I can't watch much of the Saeed video. Baldwin was so rude from the beginning - what is with these people? - Well I do know the answer to that question.
Humanity is in a huge mess, it's a cult. We are seeing the mass consequence of living a lie and humans being far removed from natural laws.
They have massive egos. They are not capable of accepting they are not as intelligent as they believe themselves to be. This explains why they despise us. We simply point out what a five-year-old can see. The would-be emperors have no clothes.
Christine! Your work is crucial to exposing their lies!
Covid does not exist and is simply a renaming of common detoxification symptoms into a new faux disease.
I have sent an email to my University condemning them for pursuing a chemical injection mandate on our precious students. This is a crime punishable by death. Taking orders is no excuse.
Any Professional pushing a virus narrative at this point is clearly in a state of cognitive dissonance and needs to be avoided.
Another huge fraud that is being exposed are vaccines! All a fraud and causing chronic illness and early death in Humans since 1721.
My library is extensive and I also have access to one of the largest private medical and Natural healing libraries in Ontario. I rely mostly on printed material for my research. Much of what I see and review on line may be altered. I use archive.org to go back and check the research documents.
Twenty years ago I felt confident in "The Lancet" "NEJM" "BMJ" "JAMA" "PubMed" to name a few. However, they all have been tainted, in my opinion, and the published papers are 50% propaganda for Big Pharma.
I appreciate what courage it takes to speak out the way you have Christine. You're a warrior and have helped thousands if not millions wake up to the corruption.
The Gatekeepers that have been active is suppressing the full truth are being exposed. All of their theories are being defeated. They were put in place to spread fear and capture power and to rob us of our health and steal from our bank accounts.
How to identify a Gatekeeper? Any person or organization that keeps pushing the false narrative about covid being something real, a virus story that invisible, never isolated particles, cause disease and that some vaccines may be necessary! All vaccines are a fraud, there are no exceptions.
Why has it taken so long for these lies to be exposed? Would it surprise to to learn that many Doctors, Professionals, Researchers have attempted but failed. Some have met with untimely deaths.
I keep gathering evidence and building my library to defend my position. I see nothing that would support a novel disease. A cover up for the environmental toxins that are released into our air, water and food.
Oh no.. Food! I could talk for days and days on all of the toxic ingredients going into our food. The food additives that cause chronic inflammation to keep us sick. Also, the glyphosate contamination keeps building.
What are the symptoms of acute glyphosate poisoning? Is that what covid is?
Everything we need to stay healthy comes from Nature!
Not medical advice. Do your own research and trust that fresh air, exercise, pure nutritious food and building a strong community will provide optimum health.
I will keep sharing your work Christine.
Thank you again for making this available of substack so we can pitch in our two cents worth.
No one will step up to debate them. There is no evidence to support germ theory! All historical attempts to demonstrate transmission and contagion have failed.
All they have in their toolbox are ad hominem responses!
People are waking up and questioning everything that is pushed upon us. It is not our responsibility to prove it one way or the other. However, when they start mandating experimental medical procedures based on fiction and blatantly breaking the Nuremberg Code we need to revolt. Even if there was a virus, there is never an appropriate reason to stomp on Human rights. Never! Their actions are clearly crimes against Humanity. All involved in the covid fraud need to be held accountable.
Best of health & truth,
Doug
ps I appreciate the bitchute link. I'm going to make some popcorn and enjoy it!
Interesting take. Could it also be that he was a "problem" for the government and they needed to "deal" with him?
I don't know what kind of doctor he was, but in the last few years, there have been dozens of naturopathic and homeopathic doctors that have had mysterious deaths. Far too many to be dismissed as coincidence.
All that is true. But, introducing the idea of no virus to the football watching, video game playing, masses, will be very difficult to do. They have been taught one way for so long, that to accept such a radical truth, is just too much to bear. Even to their own detriment. This includes very educated people as well. It's just too fantastic. But, no one will bother to check the claim on their own, either. They'd rather stay comfortable, in the slowly heating pot.
Noah preached for a hundred and twenty years to the masses about a coming flood. NOT ONE accepted his preachings.
"The most widely used structural method for the determination of high-resolution structures of biological samples is X-ray crystallography." That actually says it all, because a sample is a mixture of everything possible and what comes out of it cannot be described as a so-called "viral protein" or a so-called fictitous "virus"!! - so Dr. Saeed right when he says that a sample must first be cleaned of everything!!
The technique of analytical ultracentrifugation (AUC) was developed by Svedberg and Lysholm in 1927 (1). With AUC one is able to determine molecular weight, shape and stoichiometry of macromolecules and macromolecular complexes.
"The hydrodynamic behaviour of macromolecules under the influence of centrifugal forces is determined by their molecular size and molecular shape and the physical and chemical properties of the !!solvent!!." - "From the sedimentation velocity molecular properties like size and shape of a particle can be infered." >but NOT what it is, THIS is just an assumption/hypothesis!!! so Dr. Saeed is right again!!
Well, that too is just experimental, and NOT verified!! Have a nice day!! Bye
When I first read the Rockefeller Institute research on TMV from the 1920's, it was incredible to find that the way they were proving the disease was from a virus was taking sick plants, grinding them up, and painting the juice on the leaves of healthy plants. When the healthy plants showed the same leaf reaction, the 'disease', they concluded it must be a 'virus'.
Anyone thinking rationally could see that if there was some toxin that made the original plant sick, when they grind the plant up and paint it on another plant the toxins are still in the mix, and obviously would make the next plant sick. But the Rockefellers owned the companies that were making the chemicals that were/are making the plants sick, so they had an agenda, and therefore child-level logic couldn't prevail.
I now have another tutorial for you. It's not meant to prove that viruses exist, but maybe you'll learn something about the genetics of viruses.
First download ClustalW from here: http://www.clustal.org/clustal2/ (or run `brew install clustal-w` on Mac). ClustalW takes a file with multiple unaligned genomes, and it aligns the sequences so that the same position within each sequence corresponds to the same spot within the genome. Next open a terminal application on Mac or GNU/Linux and run the following commands, which downloads the genomes of a few SARS-like viruses and aligns them:
Then look at 1.png in your home directory. It shows a heatmap of the percentage identity between each pair of genomes, which includes a hierarchical clustering tree based on the distance matrix between the genomes.
Next you can try to just align the spike proteins, which shows you that SARS 2 is the only genome that has the PRRA insert which encodes for the furin cleavage site:
for x in prot/*;do awk -F: '$2==x{print">"$1}' "x=${x##*/}" accession;awk '/protein=(spike|surface)/{x=1;next}/^>/{x=0}x' $x;done>spike.fa
clustalw spike.fa;cat spike.aln
The HIV sequence database of the Los Alamos National Laboratory provides an easy way to download prealigned FASTA files for HIV and SIV sequences. So a third thing you can try is to go here: https://www.hiv.lanl.gov/content/sequence/NEWALIGN/align.html. For example set "Alignment type" to "Compendium", set "Organism" to "Other SIV (includes HIV1 and HIV2 sequences)", set "Region" to "GENOME", and click "Get alignment". Then you can use this R code to do hierarchical clustering of the results:
You're claiming that your suggested analysis of in-silico gene sequences, computer-generated fiction with at best a link to genetic material of unknown origin, will provide something useful to rational people?
You're ignoring the first lesson in any DPR100 class: GIGO
The whole data bank of so-called 'virus' genomes is pure garbage, with no scientific basis. If you won't get your head out of the hypothetical data that's falsely attributed to 'viruses' and go look at the origin problem, then you're just not willing to reason.
Maybe you'll finally be the first no-viruser who manages to follow these instructions, which Massey and Eric Coppolino refused to follow: https://planetwavesfm.substack.com/p/lab-release-which-lab-how-did-it/comment/12600487. If the genome of SARS 2 is made up then why can you find raw reads of SARS 2 sequencing runs which are over 1000 bases long and which have over 90% amino acid identity to the Wuhan-Hu-1 reference genome (or where the identity percent is within the error rate of the sequencing protocol)? Why have new mutations arisen over time to the raw reads of SARS 2 sequencing runs, and why are the same mutations detected by labs all over the world that use different sequencing hardware and different sequencing protocols?
Nobody is saying that none of those databank sequences exist anywhere in nature.
The 'origin problem' is that the sequences labeled 'SARS-CoV-2' are not from any real 'virus'; they're from a lab culture that's a putrifying soup containing genetic material from multitudes of sources. The lab cultures alone, without any added 'virus' sample (meaning ground-up dead animal), produce these sequences. This is why the labs all over the world use the same culture ingredients.
In other words, you cannot scientifically establish where any of those sequences actually came from. If you didn't actually isolate (for real) the 'virus' first, and sequence a pure virus sample, then the origin of the genetic material is unknown.
And hypothetically, let's say there's sequences discovered that aren't produced by the culture alone, and are therefore attributed to the 'virus' added to the culture. Since this added 'virus' is in fact just ground-up dead animals that someone claims died from the 'virus' (with no virus ever isolated from those animals), such sequences would still not be scientifically linked to any 'virus'.
And when these sequences appear to 'mutate' when run through numerous generations of lab animals, it still proves nothing about any virus. Documenting genome evolution in animals only shows that living things are innately intelligent and are adapting/changing. Assigning such changes to a mythical 'virus' that's never been isolated in more than a century of research is nothing but religious adherence to programmed beliefs.
So if the raw reads come from contaminants like Stefan Lanka says, then why are the contaminants not the best matches when you do a BLAST search for the raw reads? (Or actually in some cases the contaminants are the best matches on BLAST because some of the raw reads actually come from contaminants, but if you follow the instructions in the comment I linked and you do BLAST searches for a couple of long raw reads, you'll eventually find long reads which have high percentage identity with the genome of SARS 2.)
Since January 2020, the genome of SARS 2 has mutated at a rate of about 2-3 nucleotide changes per month, so that current variants have about 80-100 nucleotide changes from the Wuhan-Hu-1 genome. The mutations are present on the level of raw reads before the raw reads have been aligned to the reference genome and before the consensus genome has been generated from multiple overlapping raw reads. I haven't heard any of the no-virusers explain where the mutations come from. Why did in early 2020 labs all over the world start producing raw reads which featured the D614G mutation? Is the sequencing hardware somehow rigged that it looks up information from some online database for which mutations it should introduce to the raw reads at the current time and the current geographic area?
The reason the virus-truth advocates don't explain where the mutations come from is because the lab methodology does not offer the possibility of a scientific conclusion on that question. And I think you know that nobody is even attempting to answer that question. The Rockefeller medicine establishment refuses to do real controls and isolate the different components of the experiments because they know that doing so won't back up their hypothesis. And that defense of pseudo-science is where all of the money goes, so a honest scientist who endeavored to find answers would get no support whatsoever.
Assuming that the raw reads of 1000+ bases that are showing that steady 'mutation' rate are coming from the patient samples and not from the animal cell cultures, which I think is plausible, no 'virus' is required. It's simply showing that evolution is occurring in real time, not just generationally via Darwin's 'natural selection'. Animals are not machines made of metal and plastic. Our bodies have immense adaptive power, and environmental stresses that exploit a physiological weakness will push a rapid adaptation that will show as a genome 'mutation'. This is how animals survive all kinds of environmental changes and remain perfectly-adapted.
How I know that isn't important to this topic. What matters is that if there's any possibility for how those 'mutations' are happening other than via the theoretical 'virus', then your conclusions are non-scientific.
For just one example, what if there was some new environmental toxin that began to spread in late 2019/early 2020, that humans hadn't been exposed to before, and our physiology is having to adapt to?
So where's the scientific studies that have ruled out all other possibilities for genome evolution except for the 'virus' hypothesis? Without actually isolating the claimed 'virus', sequencing it directly, and then proving transmission and disease causation, it would not be possible to rule out all other possibilities. And I think you know this has not been done, and the establishment isn't even trying to answer these questions.
Exactly … the world is full of what ifs… and there is very little of reality that we know rationally, so why do people want to pretend they know stuff they can’t possibly know and then get so upset about it
The four "uncanny" inserts that were mentioned in the Indian preprint from January 2020 are GTNGTKR, YYHKNNKS, GDSSSG, and QTNSPRRA, and they are all part of the spike protein (https://www.biorxiv.org/content/10.1101/2020.01.30.927871v1). The first three inserts are included in RaTG13 and BANAL-52 but not in SARS 1, WIV1, ZX45, or ZXC21. The QTNS part of the QTNSPRRA insert is included in RaTG13 and BANAL-52, but neither of them includes the PRRA part which encodes for the furin cleavage site.
I don't know if you're familiar with using shells or if you're on Mac or GNU/Linux. But even if you're on Windows and you don't want to install the Windows Subsystem for Linux, you can still try out my third example by just installing R. And if you don't want to use shells, you can also try out running the R scripts in my comment if you get a prealigned FASTA file of SARS-like genomes from this post: https://virological.org/t/novel-2019-coronavirus-genome/319/28.
As evidence that the genome of SARS 2 was an "in silico" creation, Ben also pointed out how the first version of Wuhan-Hu-1 that was published in GenBank on January 12th was 30473 bp long, the second version that was published on January 14th was 29875 bp, and the current third version which was published on March 18th 2020 is 29903 bp long. However I think the reason why the first version was 570 bp longer than the current version was that a segment of 20 bases near the end of the genome is identical to a region of human chromosome 1 (TGTGATTTTAATAGCTTCTT), so they accidentally included a 598-base segment of human DNA after the 20-base segment as part of the first version of Wuhan-Hu-1. If you do a BLAST search for the last 618 nucleotides of the first version, it has 99.68% identity to a result titled "Human DNA sequence from clone RP11-173E24 on chromosome 1q31.1-31.3, complete sequence". You can simply copy positions 29856 to 30473 from here: https://www.ncbi.nlm.nih.gov/nuccore/NC_045512.1. Then paste it here and press the BLAST button: https://blast.ncbi.nlm.nih.gov/Blast.cgi. See my comment here for a more detailed explanation: https://usmortality.substack.com/p/sars-cov-2-genome-assembly/comment/13407456.
Sorry, I agree that I should've posted the correct code instead of saying why I think Ben's code was wrong. I asked Kevin McKernan why Ben's MEGAHIT script didn't reproduce the genome of Wuhan-Hu-1, but he replied: "He didn't trim the reads and as a result had a different length poly A tail." (https://anandamide.substack.com/p/failure-of-the-linearization-reaction/comment/13626862) Even though actually Ben's longest contiguous read was missing the last 102 bases of the third version of Wuhan-Hu-1 at Genbank, and the poly(A) tail of Wuhan-Hu-1 is only 33 bases long, so Ben's longest contig was also missing 69 bases before the poly(A) tail.
I was now able to reproduce Ben's MEGAHIT pipeline, and at first when I didn't use Trimmomatic to trim the reads, my longest contig was identical to Ben's results, but when I added Trimmomatic to my pipeline, my longest contig ended up missing only the last 30 bases of Wuhan-Hu-1: https://usmortality.substack.com/p/sars-cov-2-genome-assembly/comment/13659949. I probably used the wrong parameters with Trimmomatic though or my pipeline is still missing other parts.
Jun 15, 2023·edited Jun 18, 2023Liked by Christine Massey FOIs
Ok it sounds like you’re used to living in a Metaverse where all this jargon means you must know what is going on in the real world… but it doesn’t…. You don’t know the origins of sickness and death. Nobody does. But go ahead and run your computer models and pretend if it soothes your existential fears
Hi and cheers, Christine Massey.
I think DelBigtree's argument is ridiculous, the fact viruses are not pathogenic sars cov2 never existed is much more important than the faked origin. Who cares about the origin {WHO would} if the world learns it was all based on fraud, a plan and not a pandemic would allow them to get away with it?
Now is the time, not later, anyone who's thinking now they will pull another one out of their hat.
Isn't it awful enough that they've conned billions into believing in long covid.
In fact the time was at least 3 yrs ago when the governmental, WHO UN. Rockefeller & co's lockstep began.
Imagine grown popular men with large followings & website like Del, RFK who were /are purportedly against the injuring and mandating of vaccines to children for their pleasure for being in institutions which are not even educating them. 12 yrs spent to be indoctrinated into becoming global citizens who follow the rules, don't question.
I can't fathom how these men or their fellows never once did any research to see if vaccines where ever required, if the germ theory had it right, being against the poisons which never saved anyone, is after all not a new phenomena.
Hmm.
In any case I'm glad to hear that you and your friend have good news on the false criminal "charges" against you both. Thank you for your diligence and all the additional information on this post.
Cheers, Mia
P.s Christine, I wonder have you, heard of the Report from Iron Mountain?
Thanks Mia, and I agree. Report from Iron Mountain sounds vaguely familiar.
You're welcome, Christine and thanks again for your work.
Here's a link to it.
https://ia802702.us.archive.org/17/items/pdfy-A5uQx1ByqfwWuHma/Report_from_Iron_Mountain%201967.pdf
thank you
Christine Massey, Have you seen this from Dr Sam Bailey? https://fluoridealert.dm.networkforgood.com/emails/2465983?
Hi Christine, this is not related to this excellent article but I can’t think of any other way to contact you (are you still banned from Twitter?).
I just read a Substack article by Martin Neil, Where Are The Numbers and in the comments someone (Geoff Pain) said: “The first isolation and full characterization of the Wuhan Covid 19 was done in Melbourne, Victoria, Australia in January 2020. It was isolated, examined by Transmission Electron Microscopy and confirmed to a Coronavirus by PCR, then full Sequencing, then successful Culture and Export.
https://geoffpain.substack.com/p/first-detected-covid19-case-arrived”
Is this ‘the one that got away’ 🤭 Christine? I think it unlikely but I would love to hear what you think about this huge success!
Interesting, I had left Geoff a detailed comment about that bogus study (which has been featured on my site since 2020: https://www.fluoridefreepeel.ca/australian-dept-of-health-has-no-record-of-covid-19-virus-isolation/) and the comment is no longer there.
*Correction* the link above works if you delete the final " . Your comment was prob deleted as 'inconvenient' to his 'truth'
Caly et al. (2020), "Isolation and rapid sharing of the 2019 novel coronavirus (SARS-CoV-2) from the first patient diagnosed with COVID-19 in Australia." DOI: 10.5694/mja2.50569
https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7228321/
It, too, is fraud.
FYI Christine! Fluoride finding, just in case you missed it. Likely not. However, I don't want to assume.
https://fluoridealert.dm.networkforgood.com/emails/2465983?recipient_id=mm17CzRN74OK3NF_WE7ibw%7C%7Cc3R1YXJ0QGZsdW9yaWRlYWxlcnQub3Jn
I notice that the like button on substack are still very bouncy! I've just liked the same comment THREE TIMES before it would stick. I might have to check back later to see if it has vanished AGAIN.
The idea of prosecutions is a red herring. He’s got nuthin’. His followers are sheep and don’t question his stories.
His revenue stream is increasingly at risk. His Wall Street sponsors have him on a short leash.
Even if Del can't admit there's no virus, I wish he'd hammer home the obvious point that there is no TEST for this virus. And it hasn't been proven that "the virus" causes "those symptoms". If he could just completely debunk the use of PCR as a diagnostic tool, that would be a huge step in the right direction. They're still talking (in the mainstream news) about using it to test wastewater for Covid particles. That would easily be a justification for locking us all down again.
Del Bigtree is deceiving and manipulating his viewership. Disgusting. I can't watch much of the Saeed video. Baldwin was so rude from the beginning - what is with these people? - Well I do know the answer to that question.
Humanity is in a huge mess, it's a cult. We are seeing the mass consequence of living a lie and humans being far removed from natural laws.
They have massive egos. They are not capable of accepting they are not as intelligent as they believe themselves to be. This explains why they despise us. We simply point out what a five-year-old can see. The would-be emperors have no clothes.
Christine! Your work is crucial to exposing their lies!
Covid does not exist and is simply a renaming of common detoxification symptoms into a new faux disease.
I have sent an email to my University condemning them for pursuing a chemical injection mandate on our precious students. This is a crime punishable by death. Taking orders is no excuse.
Any Professional pushing a virus narrative at this point is clearly in a state of cognitive dissonance and needs to be avoided.
Another huge fraud that is being exposed are vaccines! All a fraud and causing chronic illness and early death in Humans since 1721.
My library is extensive and I also have access to one of the largest private medical and Natural healing libraries in Ontario. I rely mostly on printed material for my research. Much of what I see and review on line may be altered. I use archive.org to go back and check the research documents.
Twenty years ago I felt confident in "The Lancet" "NEJM" "BMJ" "JAMA" "PubMed" to name a few. However, they all have been tainted, in my opinion, and the published papers are 50% propaganda for Big Pharma.
I appreciate what courage it takes to speak out the way you have Christine. You're a warrior and have helped thousands if not millions wake up to the corruption.
The Gatekeepers that have been active is suppressing the full truth are being exposed. All of their theories are being defeated. They were put in place to spread fear and capture power and to rob us of our health and steal from our bank accounts.
How to identify a Gatekeeper? Any person or organization that keeps pushing the false narrative about covid being something real, a virus story that invisible, never isolated particles, cause disease and that some vaccines may be necessary! All vaccines are a fraud, there are no exceptions.
Why has it taken so long for these lies to be exposed? Would it surprise to to learn that many Doctors, Professionals, Researchers have attempted but failed. Some have met with untimely deaths.
I keep gathering evidence and building my library to defend my position. I see nothing that would support a novel disease. A cover up for the environmental toxins that are released into our air, water and food.
Oh no.. Food! I could talk for days and days on all of the toxic ingredients going into our food. The food additives that cause chronic inflammation to keep us sick. Also, the glyphosate contamination keeps building.
What are the symptoms of acute glyphosate poisoning? Is that what covid is?
Everything we need to stay healthy comes from Nature!
Not medical advice. Do your own research and trust that fresh air, exercise, pure nutritious food and building a strong community will provide optimum health.
I will keep sharing your work Christine.
Thank you again for making this available of substack so we can pitch in our two cents worth.
Okay, maybe I've added a nickel's worth?
Best of Health and Truth!
You're welcome Christine!
No one will step up to debate them. There is no evidence to support germ theory! All historical attempts to demonstrate transmission and contagion have failed.
All they have in their toolbox are ad hominem responses!
People are waking up and questioning everything that is pushed upon us. It is not our responsibility to prove it one way or the other. However, when they start mandating experimental medical procedures based on fiction and blatantly breaking the Nuremberg Code we need to revolt. Even if there was a virus, there is never an appropriate reason to stomp on Human rights. Never! Their actions are clearly crimes against Humanity. All involved in the covid fraud need to be held accountable.
Best of health & truth,
Doug
ps I appreciate the bitchute link. I'm going to make some popcorn and enjoy it!
Christine - I am knocked out by the level of your commitment.. Thankyou!
Interesting take. Could it also be that he was a "problem" for the government and they needed to "deal" with him?
I don't know what kind of doctor he was, but in the last few years, there have been dozens of naturopathic and homeopathic doctors that have had mysterious deaths. Far too many to be dismissed as coincidence.
All that is true. But, introducing the idea of no virus to the football watching, video game playing, masses, will be very difficult to do. They have been taught one way for so long, that to accept such a radical truth, is just too much to bear. Even to their own detriment. This includes very educated people as well. It's just too fantastic. But, no one will bother to check the claim on their own, either. They'd rather stay comfortable, in the slowly heating pot.
Noah preached for a hundred and twenty years to the masses about a coming flood. NOT ONE accepted his preachings.
To go back to the video with Dr. Saeed to come:
"The most widely used structural method for the determination of high-resolution structures of biological samples is X-ray crystallography." That actually says it all, because a sample is a mixture of everything possible and what comes out of it cannot be described as a so-called "viral protein" or a so-called fictitous "virus"!! - so Dr. Saeed right when he says that a sample must first be cleaned of everything!!
https://www.fz-juelich.de/de/ibi/ibi-7/forschung/methoden/x-ray-crystallography
The technique of analytical ultracentrifugation (AUC) was developed by Svedberg and Lysholm in 1927 (1). With AUC one is able to determine molecular weight, shape and stoichiometry of macromolecules and macromolecular complexes.
https://www.fz-juelich.de/de/ibi/ibi-7/forschung/methoden/analytical-ultracentrifugation
"The hydrodynamic behaviour of macromolecules under the influence of centrifugal forces is determined by their molecular size and molecular shape and the physical and chemical properties of the !!solvent!!." - "From the sedimentation velocity molecular properties like size and shape of a particle can be infered." >but NOT what it is, THIS is just an assumption/hypothesis!!! so Dr. Saeed is right again!!
Well, that too is just experimental, and NOT verified!! Have a nice day!! Bye
Dear Christine, thank you very much for your great work!!
Let's see how a so-called "tobacco virus" is searched for:
https://www.interciencia.net/wp-content/uploads/2019/01/38-TANG-WANG-44-01.pdf
Now you type these nucleotide sequences into the BLAST search https://blast.ncbi.nlm.nih.gov/Blast.cgi?PAGE_TYPE=BlastSearch&BLAST_SPEC=OGP__9606__9558&LINK_LOC=blasthome , every single letter group at Enter Query Sequence, scroll down and click on the blue box on the left, wait for the result to come up - nucleotide sequences have humans, animals, plants - started in the 19th century industrialization in Europe, but also in America https://ehne.fr/en/encyclopedia/themes/material-civilization/energy-transition-and-environment/gas-power-and-urban-environment-in-europe-during-19th-century - https://www.sciencehistory.org/distillations/an-everyday-poison - https://www.scientificamerican.com/article/arsenic-s-afterlife-how-scientists-learned-to-identify-poison-victims-excerpt/ - the environment was polluted with chemicals and THAT produces disease in humans, in animals and also in plants - that was the case then and is still the case today, but it has nothing to do with a fictitious "virus" to do!! Everything regenerates itself every day and this regeneration causes cells to die, which then have to be shed and the cell debris that still has parts of nucleotides is then searched for - this is not science and has nothing to do with "viruses"!! And the same is at all so-called fictitious "viruses"!
https://maryann255.substack.com/p/the-truth-is-always-on-the-other-66c
When I first read the Rockefeller Institute research on TMV from the 1920's, it was incredible to find that the way they were proving the disease was from a virus was taking sick plants, grinding them up, and painting the juice on the leaves of healthy plants. When the healthy plants showed the same leaf reaction, the 'disease', they concluded it must be a 'virus'.
Anyone thinking rationally could see that if there was some toxin that made the original plant sick, when they grind the plant up and paint it on another plant the toxins are still in the mix, and obviously would make the next plant sick. But the Rockefellers owned the companies that were making the chemicals that were/are making the plants sick, so they had an agenda, and therefore child-level logic couldn't prevail.
What was said during O'Keefe's 'vacation' with RJK jr.? How to moonwalk?
I meant O'Keefe obviously colluded with RJK jr. on certain viral topics when they 'shared' a same holiday.
O'Keefe went to see JRK Jr. after he was ousted from PV:
https://thepostmillennial.com/update-james-okeefe-posts-photo-with-robert-f-kennedy-jr-project-veritas-releases-new-statement
I now have another tutorial for you. It's not meant to prove that viruses exist, but maybe you'll learn something about the genetics of viruses.
First download ClustalW from here: http://www.clustal.org/clustal2/ (or run `brew install clustal-w` on Mac). ClustalW takes a file with multiple unaligned genomes, and it aligns the sequences so that the same position within each sequence corresponds to the same spot within the genome. Next open a terminal application on Mac or GNU/Linux and run the following commands, which downloads the genomes of a few SARS-like viruses and aligns them:
printf %s\\n SARS_2_Wuhan-Hu-1.2020:NC_045512 SARS_1_Tor2.2003:NC_004718 RaTG13_Yunnan_horseshoe.2020:MN996532 Zhoushan_bat_virus_ZC45.2018:MG772933 Zhoushan_bat_virus_ZXC21.2018:MG772934 BANAL-52_Laos_bat.2020:MZ937000 Bat_SARS-like_WIV1.2013:KF367457 Bat_SARS_HKU3-7.2010:GQ153542 Bat_SARS-like_Rs4247.2017:KY417148 >accession
for x in `cut -d: -f2 accession`;do curl "https://eutils.ncbi.nlm.nih.gov/entrez/eutils/efetch.fcgi?db=nuccore&rettype=fasta&id=$x";done>sars.fa
clustalw sars.fa -output=fasta
Next download R from here: https://cran.r-project.org. Then open the R console application and copy and paste this code:
install.packages("bio3d");install.packages("pheatmap");install.packages("colorspace")
library(bio3d);library(pheatmap);library(colorspace)
dist=1-seqidentity(bio3d::read.fasta("sars.fasta"))
fa=readLines("sars.fa")
name=read.table(text=paste(sub(" ","\t",sub("^>","",fa[grepl("^>",fa)])),collapse="\n"),sep="\t",r=1)
colnames(dist)=rownames(dist)=sub(", complete genome","",name[rownames(dist),])
hc=as.hclust(reorder(as.dendrogram(hclust(as.dist(dist))),cmdscale(dist)[,1]))
pal=colorRampPalette(hex(HSV(seq(240,0),.5,1)))(256)
pheatmap(100*(1-dist),filename="1.png",clustering_callback=\(...)hc,legend=F,cellwidth=18,cellheight=18,fontsize=9,border_color=NA,display_numbers=T,number_format="%.0f",fontsize_number=8,number_color="black",pal)
Then look at 1.png in your home directory. It shows a heatmap of the percentage identity between each pair of genomes, which includes a hierarchical clustering tree based on the distance matrix between the genomes.
Next you can try to just align the spike proteins, which shows you that SARS 2 is the only genome that has the PRRA insert which encodes for the furin cleavage site:
mkdir prot;for x in `cut -d: -f2 accession`;do curl "https://eutils.ncbi.nlm.nih.gov/entrez/eutils/efetch.fcgi?db=nuccore&rettype=fasta_cds_aa&id=$x">prot/$x;done
for x in prot/*;do awk -F: '$2==x{print">"$1}' "x=${x##*/}" accession;awk '/protein=(spike|surface)/{x=1;next}/^>/{x=0}x' $x;done>spike.fa
clustalw spike.fa;cat spike.aln
The HIV sequence database of the Los Alamos National Laboratory provides an easy way to download prealigned FASTA files for HIV and SIV sequences. So a third thing you can try is to go here: https://www.hiv.lanl.gov/content/sequence/NEWALIGN/align.html. For example set "Alignment type" to "Compendium", set "Organism" to "Other SIV (includes HIV1 and HIV2 sequences)", set "Region" to "GENOME", and click "Get alignment". Then you can use this R code to do hierarchical clustering of the results:
dist=1-bio3d::seqidentity(bio3d::read.fasta("SIV_COM_2021_genome_DNA.fasta"))
hc=as.hclust(reorder(as.dendrogram(hclust(as.dist(dist))),cmdscale(dist)[,1]))
png("2.png",w=7000,h=1400,res=144)
plot(hc)
dev.off()
You're claiming that your suggested analysis of in-silico gene sequences, computer-generated fiction with at best a link to genetic material of unknown origin, will provide something useful to rational people?
You're ignoring the first lesson in any DPR100 class: GIGO
The whole data bank of so-called 'virus' genomes is pure garbage, with no scientific basis. If you won't get your head out of the hypothetical data that's falsely attributed to 'viruses' and go look at the origin problem, then you're just not willing to reason.
Maybe you'll finally be the first no-viruser who manages to follow these instructions, which Massey and Eric Coppolino refused to follow: https://planetwavesfm.substack.com/p/lab-release-which-lab-how-did-it/comment/12600487. If the genome of SARS 2 is made up then why can you find raw reads of SARS 2 sequencing runs which are over 1000 bases long and which have over 90% amino acid identity to the Wuhan-Hu-1 reference genome (or where the identity percent is within the error rate of the sequencing protocol)? Why have new mutations arisen over time to the raw reads of SARS 2 sequencing runs, and why are the same mutations detected by labs all over the world that use different sequencing hardware and different sequencing protocols?
You seem to have missed the point completely.
Nobody is saying that none of those databank sequences exist anywhere in nature.
The 'origin problem' is that the sequences labeled 'SARS-CoV-2' are not from any real 'virus'; they're from a lab culture that's a putrifying soup containing genetic material from multitudes of sources. The lab cultures alone, without any added 'virus' sample (meaning ground-up dead animal), produce these sequences. This is why the labs all over the world use the same culture ingredients.
In other words, you cannot scientifically establish where any of those sequences actually came from. If you didn't actually isolate (for real) the 'virus' first, and sequence a pure virus sample, then the origin of the genetic material is unknown.
And hypothetically, let's say there's sequences discovered that aren't produced by the culture alone, and are therefore attributed to the 'virus' added to the culture. Since this added 'virus' is in fact just ground-up dead animals that someone claims died from the 'virus' (with no virus ever isolated from those animals), such sequences would still not be scientifically linked to any 'virus'.
And when these sequences appear to 'mutate' when run through numerous generations of lab animals, it still proves nothing about any virus. Documenting genome evolution in animals only shows that living things are innately intelligent and are adapting/changing. Assigning such changes to a mythical 'virus' that's never been isolated in more than a century of research is nothing but religious adherence to programmed beliefs.
So if the raw reads come from contaminants like Stefan Lanka says, then why are the contaminants not the best matches when you do a BLAST search for the raw reads? (Or actually in some cases the contaminants are the best matches on BLAST because some of the raw reads actually come from contaminants, but if you follow the instructions in the comment I linked and you do BLAST searches for a couple of long raw reads, you'll eventually find long reads which have high percentage identity with the genome of SARS 2.)
Since January 2020, the genome of SARS 2 has mutated at a rate of about 2-3 nucleotide changes per month, so that current variants have about 80-100 nucleotide changes from the Wuhan-Hu-1 genome. The mutations are present on the level of raw reads before the raw reads have been aligned to the reference genome and before the consensus genome has been generated from multiple overlapping raw reads. I haven't heard any of the no-virusers explain where the mutations come from. Why did in early 2020 labs all over the world start producing raw reads which featured the D614G mutation? Is the sequencing hardware somehow rigged that it looks up information from some online database for which mutations it should introduce to the raw reads at the current time and the current geographic area?
The reason the virus-truth advocates don't explain where the mutations come from is because the lab methodology does not offer the possibility of a scientific conclusion on that question. And I think you know that nobody is even attempting to answer that question. The Rockefeller medicine establishment refuses to do real controls and isolate the different components of the experiments because they know that doing so won't back up their hypothesis. And that defense of pseudo-science is where all of the money goes, so a honest scientist who endeavored to find answers would get no support whatsoever.
Assuming that the raw reads of 1000+ bases that are showing that steady 'mutation' rate are coming from the patient samples and not from the animal cell cultures, which I think is plausible, no 'virus' is required. It's simply showing that evolution is occurring in real time, not just generationally via Darwin's 'natural selection'. Animals are not machines made of metal and plastic. Our bodies have immense adaptive power, and environmental stresses that exploit a physiological weakness will push a rapid adaptation that will show as a genome 'mutation'. This is how animals survive all kinds of environmental changes and remain perfectly-adapted.
How I know that isn't important to this topic. What matters is that if there's any possibility for how those 'mutations' are happening other than via the theoretical 'virus', then your conclusions are non-scientific.
For just one example, what if there was some new environmental toxin that began to spread in late 2019/early 2020, that humans hadn't been exposed to before, and our physiology is having to adapt to?
So where's the scientific studies that have ruled out all other possibilities for genome evolution except for the 'virus' hypothesis? Without actually isolating the claimed 'virus', sequencing it directly, and then proving transmission and disease causation, it would not be possible to rule out all other possibilities. And I think you know this has not been done, and the establishment isn't even trying to answer these questions.
Exactly … the world is full of what ifs… and there is very little of reality that we know rationally, so why do people want to pretend they know stuff they can’t possibly know and then get so upset about it
If you don't want to use shells, you can also do multiple sequence alignment by using a web GUI for Clustal Omega. For example open the pages for some SARS-like genomes at the NBCI's nucleotide database: https://www.ncbi.nlm.nih.gov/nuccore/NC_045512, https://www.ncbi.nlm.nih.gov/nuccore/NC_004718, https://www.ncbi.nlm.nih.gov/nuccore/MN996532, https://www.ncbi.nlm.nih.gov/nuccore/MG772933, https://www.ncbi.nlm.nih.gov/nuccore/MG772934, https://www.ncbi.nlm.nih.gov/nuccore/MZ937000, https://www.ncbi.nlm.nih.gov/nuccore/KF367457, https://www.ncbi.nlm.nih.gov/nuccore/GQ153542, https://www.ncbi.nlm.nih.gov/nuccore/KY417148. Search for "spike" on each page and copy the spike protein sequences into a FASTA file, where you put the name of each sequence on a line that starts with a greater than sign and the sequence below it. Or alternatively you can copy a premade FASTA file from here: https://pastebin.com/raw/tZcyDfKf. Then paste the FASTA file here and press the submit button: https://www.ebi.ac.uk/Tools/msa/clustalo/.
The four "uncanny" inserts that were mentioned in the Indian preprint from January 2020 are GTNGTKR, YYHKNNKS, GDSSSG, and QTNSPRRA, and they are all part of the spike protein (https://www.biorxiv.org/content/10.1101/2020.01.30.927871v1). The first three inserts are included in RaTG13 and BANAL-52 but not in SARS 1, WIV1, ZX45, or ZXC21. The QTNS part of the QTNSPRRA insert is included in RaTG13 and BANAL-52, but neither of them includes the PRRA part which encodes for the furin cleavage site.
I don't know if you're familiar with using shells or if you're on Mac or GNU/Linux. But even if you're on Windows and you don't want to install the Windows Subsystem for Linux, you can still try out my third example by just installing R. And if you don't want to use shells, you can also try out running the R scripts in my comment if you get a prealigned FASTA file of SARS-like genomes from this post: https://virological.org/t/novel-2019-coronavirus-genome/319/28.
BTW Alec Zeck was making a big deal out of this article by Ben from USMortality: https://usmortality.substack.com/p/sars-cov-2-genome-assembly. Ben failed to reproduce the genome of Wuhan-Hu-1 using MEGAHIT, but I think it's because his pipeline was missing several steps like doing quality control with FastQC, merging the reads with SeqPrep, and trimming the reads with Trimmomatic: https://github.com/USMortality/Megahit-SARS-CoV-2/blob/master/megahit.sh, https://research.csc.fi/metagenomics_quality.
As evidence that the genome of SARS 2 was an "in silico" creation, Ben also pointed out how the first version of Wuhan-Hu-1 that was published in GenBank on January 12th was 30473 bp long, the second version that was published on January 14th was 29875 bp, and the current third version which was published on March 18th 2020 is 29903 bp long. However I think the reason why the first version was 570 bp longer than the current version was that a segment of 20 bases near the end of the genome is identical to a region of human chromosome 1 (TGTGATTTTAATAGCTTCTT), so they accidentally included a 598-base segment of human DNA after the 20-base segment as part of the first version of Wuhan-Hu-1. If you do a BLAST search for the last 618 nucleotides of the first version, it has 99.68% identity to a result titled "Human DNA sequence from clone RP11-173E24 on chromosome 1q31.1-31.3, complete sequence". You can simply copy positions 29856 to 30473 from here: https://www.ncbi.nlm.nih.gov/nuccore/NC_045512.1. Then paste it here and press the BLAST button: https://blast.ncbi.nlm.nih.gov/Blast.cgi. See my comment here for a more detailed explanation: https://usmortality.substack.com/p/sars-cov-2-genome-assembly/comment/13407456.
Sorry, I agree that I should've posted the correct code instead of saying why I think Ben's code was wrong. I asked Kevin McKernan why Ben's MEGAHIT script didn't reproduce the genome of Wuhan-Hu-1, but he replied: "He didn't trim the reads and as a result had a different length poly A tail." (https://anandamide.substack.com/p/failure-of-the-linearization-reaction/comment/13626862) Even though actually Ben's longest contiguous read was missing the last 102 bases of the third version of Wuhan-Hu-1 at Genbank, and the poly(A) tail of Wuhan-Hu-1 is only 33 bases long, so Ben's longest contig was also missing 69 bases before the poly(A) tail.
I was now able to reproduce Ben's MEGAHIT pipeline, and at first when I didn't use Trimmomatic to trim the reads, my longest contig was identical to Ben's results, but when I added Trimmomatic to my pipeline, my longest contig ended up missing only the last 30 bases of Wuhan-Hu-1: https://usmortality.substack.com/p/sars-cov-2-genome-assembly/comment/13659949. I probably used the wrong parameters with Trimmomatic though or my pipeline is still missing other parts.
Ok it sounds like you’re used to living in a Metaverse where all this jargon means you must know what is going on in the real world… but it doesn’t…. You don’t know the origins of sickness and death. Nobody does. But go ahead and run your computer models and pretend if it soothes your existential fears